WWW.PDF.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Разные материалы
 

«Е.В. Давиденко ОСНОВНЫЕ ПРИЧИНЫ МАССОВОГО УСЫХАНИЯ ЯСЕНЯ В ЦЕНТРАЛЬНЫХ И ВОСТОЧНЫХ ОБЛАСТЯХ УКРАИНЫ Введение. В последние 20 лет в Европе наблюдается стремительное распространение грибного ...»

УДК 630.443

Е.В. Давиденко

ОСНОВНЫЕ ПРИЧИНЫ МАССОВОГО УСЫХАНИЯ ЯСЕНЯ

В ЦЕНТРАЛЬНЫХ И ВОСТОЧНЫХ ОБЛАСТЯХ УКРАИНЫ

Введение. В последние 20 лет в Европе наблюдается стремительное

распространение грибного патогена – Hymenoscyphus fraxineus

(T. Kowalski) Baral, Queloz & Hosoya (анаморфа Chalara fraxinea), который

вызывает массовое усыхание ясеня (ash dieback) и является инвазивным

видом. Русского названия этой болезни еще нет, поэтому авторы воспользовались общим термином «усыхание» [Шабунин и др., 2012]. Массовая гибель ясеня обыкновенного, инфицированного H. fraxineus, впервые зарегистрирована в начале 1990-х гг. в Польше и Литве. Затем болезнь распространилась в северных и центральных европейских странах, а в 2007 г.

усыхание ясеня зарегистрировано в Венгрии и Словении, позже во Франции (2008 г.) и Италии (2009 г.) [Puatasso et al., 2013]. Последние сообщения получены из Бельгии и Нидерландов (2011 г.), Украины (2011 г.), России (2012 г.), Беларуси (2012 г.), Англии и Ирландии (2012 г.). На сегодняшний день (2014 г.) гибель ясеня вследствие инфицирования H. fraxineus происходит в 25 европейских странах [Gross et al., 2014]. Патоген впервые был описан Т. Ковальським в 2006 г. как новый вид Chalara fraxinea, а в 2010 г. молекулярные исследования с использованием ITS региона определили, что это новый вид для науки – Hymenoscyphus pseudoalbidus Queloz, Grnig, Berndt, T.

Kowalski, T.N. Sieber & Holdenr, очень похожий на вид Hymenoscyphus albidus (Gillet) W. Phillips, который является безобидным сапротрофом – деструктором опавшей листвы, известным с 1887 г. [Kowalski, 2006, Queloz et al, 2011]. Оба вида морфологически очень близки и их трудно различить. В 2012 г. была установлена идентичность H. pseudoalbidus и азиатского вида Lambertella albida (Gillet) Korf, который был обнаружен на черешках ясеня маньчжурского (Fraxinus mandshurica Rupr.) в Японии и описан Hosoya et al. в 1993 г. [Zhao et al, 2012]. Этот гриб является слабым патогеном ясеня маньчжурского в Японии, тогда как C. fraxinea доминирует в насаждениях в Европе, где отмечалась массовая гибель ясеня обыкновенного [Zhao et al., 2012, Kowalski, Holdenrieder, 2009]. В 2014 г., в соответствии с правилами номенклатуры Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211 грибов, видовое название было изменено с pseudoalbidus на fraxineus [Barall et al., 2014].

Основные симптомы болезни – это усыхание листьев, быстрое отмирание кроны, некрозы на черешках, побегах, листьях, обесцвечивание и некроз древесины и др. [Gross et al., 2012, 2014].

Ясень обыкновенный (Fraxinus excelsior L.) – наиболее распространенный вид этого рода в странах Европы с умеренным климатом, в том числе на Украине [Давиденко, Мешкова, 2014]. Начиная с 2006 года, отмечено ухудшение состояния ясеня на пробных площадях, а в 2010 году на деревьях ясеня обыкновенного в Харьковской области впервые были зафиксированы морфологические симптомы, характерные для новой болезни. Наличие возбудителя болезни (H. fraxineus) на Украине было впервые подтверждено молекулярными методами в 2011 году, но частота встречаемости патогена была низкой [Давиденко, Мешкова, 2014, Davydenko et al., 2013].

Целью нашей работы является выявление основных причин усыхания ясеня в восточных и центральных областях Украины и определение основных эффективных методов идентификации заболевания ash dieback.

Материалы и методы. Нами были обследованы смешанные и чистые ясеневые насаждения в трех областях Украины (Харьковской, Житомирской и Сумской) на 12 пробных площадях в 2011–2014 гг. На каждой пробной площади проводили оценку состояния ясеня в июне–августе.

Санитарное состояние деревьев оценивали по шести категориям (I – здоровые; II – ослабленные; III – сильно ослабленные; IV – усыхающие; V – свежий сухостой; VI – старый сухостой). Индекс состояния (Iс) насаждений, который характеризует общую жизнеспособность насаждений, рассчитывался путем определения суммы произведений количества деревьев каждой категории состояния на бал соответствующей категории состояния и деления этой суммы на общее количество деревьев.

Также для каждого дерева визуально отмечали патологические симптомы, такие как состояние кроны, усыхание листьев и побегов, некроз тканей, раковые и опухолевые образования, наличие плодовых тел дереворазрушающих грибов, повреждения листогрызущими насекомыми и ксилофагами и др. Регистрировали видовой состав насекомых и грибов (если это было возможно по морфологическим признакам – по типичным повреждениям, плодовым телам грибов, наличию имаго насекомых и т. д.) [Давиденко, Мешкова, 2013, 2014].

Е.В. Давиденко Для выяснения степени распространения H. fraxineus на пробных площадях дополнительно визуально оценивали наличие симптомов отмирания по причине возможного заражения H.

fraxineus по шкале:

0 – отсутствие симптомов болезни;

1 – наличие косвенных симптомов (неодновременное распускание листьев, некрозы на растущих побегах и мертвых ветвях до 10 % объема кроны;

2 – мертвые побеги и ветви с наличием некрозов составляют от 10 до 50 % объема кроны;

3 – усыхание более 50 % кроны, обесцвечивание древесины, некрозы древесины, наличие усохших побегов, ветвей, листьев;

4 – 100 % повреждения кроны, на все еще зеленых побегах четкие некрозы, стволовой и комлевой некрозы [Давиденко и др., 2013].

При обнаружении типичных симптомов болезни усыхания ясеня, побеги с наличием некрозов (до 10 см длиной) срезали и упаковывали в бумажные пакеты. В течение 24 ч образцы некрозов сортировали, вырезали кусочки древесины длиной 15–20 мм и хранили в холодильнике в течение 1–3 дней. Эти образцы использовали для культивирования на 3 % солодово-агаровой питательной среде (malt extract agar – MEA) для выделения чистой культуры патогена и прямого секвенирования. Для подтверждения наличия или отсутствия H. fraxineus использовался метод полимеразной цепной реакции (ПЦР) с использованием видоспецифичных праймеров [Bengtsson 2013].

Проведение молекулярно-диагностических исследований осуществлялось двумя способами – методом прямого секвенирования ДНК образцов некрозов и секвенированием ДНК чистой культуры гриба, выделенной из пораженных тканей.

Выделение грибов из пораженных тканей в чистую культуру. Образцы некрозов срезали на 1–2 мм выше видимой границы некроза. Затем нарезали фрагменты размером 5–10 мм, освобождали от коры, стерилизовали в 96 %-м этиловом спирте и в 2 %-м гипохлорите натрия и вновь промывали в 96 %-м спирте. После высушивания образцы помещали в отдельные чашки Петри на агаровую среду Хагема (на 1 л среды – 20 г агар-агара, 5 г глюкозы, 5 г солодового экстракта, 0,5 г MgSO47H2O; 0,5 г K2HPO4; 0,5 г NH4NO3) и модифицированную среду Хагема с добавлением 100 г свежих листьев и побегов ясеня перед автоклавированием. Полученные культуры распределяли по морфотипам с помощью светового микроскопа Leica DM LS с цифровым изображением. Каждый морфотип использовали для определения вида. Отдельно регистрировали культуры H. fraxineus для подтверждения данного вида молекулярными методами (Cleary M.R. et al., 2013).

Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211 Молекулярная идентификация видов. Для определения неизвестных морфотипов, а также для подтверждения определенных морфотипов грибных культур проводили идентификацию с использованием молекулярных методов: выделение геномной ДНК из мицелия, амплификация части интронной транскрибирующейся области (ITS region), с использованием выделенной ДНК в качестве матрицы с помощью ПЦР со специфическими праймерами, визуализация ампликонов.

Для этого экстракцию ДНК проводили с использованием СТАВ буфера (1M Tris, 5 M NaCl, 0,5 M EDTA, 3 % СТАВ). Пробы очищали добавлением хлороформа, после чего проводили центрифугирование при 10000 об./мин в течение 15 мин. Осаждение ДНК проводили добавлением эквивалентного объема холодного изопропанола с последующей выдержкой в течение 30–60 мин. После этого проводили центрифугирование при 13 000 об./мин в течение 30 мин. Осадок промывали 70 %-м этанолом, осадок подсушивали в пробирках при комнатной температуре и растворяли его в 50 мкл воды [Davydenko et al., 2013]. Амплификацию проводили с использованием праймеров ITS1F и ITS4. Каждая ПЦР содержала 200 мкМ дезоксирибонуклеотид трифосфатов, 0,2 мкМ каждого праймера, 0,03 ед./мкл Dream Taq-полимеразы и смеси реакционного буфера с хлоридом магния в количестве 2,25 мМ. Общий объем реакционной смеси составил 15 мкл [Ioos et al., 2009, Davydenko et al., 2013].

Амплификацию проводили с использованием Applied Biosystems GeneAmp PCR System 2700 термоциклера (Foster City, CA, USA). Первоначальную денатурацию осуществляли при 95 °C в течение 5 мин, затем 35 циклов амплификации: денатурация при 95 °C в течение 30 с, отжиг при 60 °С в течение 30 с и элонгация при 72 °С в течение 30 с. Амплификация закончилась последним шагом элонгации при 72 °С в течение 7 мин. Электрофорез проводили в 1 %-м агарозном геле, при напряжении 120 В в течение 45 мин. Визуализировали ДНК в УФ-свете [Ioos et al., 2009, Gross et al., 2012].

Секвенирование продуктов реакции было выполнено компанией Macrogen Inc, Сеул, Корея, с использованием ABI 3730 XL автоматизированных секвенсоров (Applied Biosystems, Foster City, CA, USA). Исходные данные последовательности были проанализированы с использованием программы SeqMan Pro 10.0 пакет DNASTAR (DNASTAR, Мэдисон, Висконсин, США). Для сравнения и видовой идентификации были использованы базы данных в GenBank (http://www.ncbi.nlm.nih.gov/genbank/).

Прямое секвенирование образцов с использованием специфических праймеров. Для подтверждения наличия H. fraxineus в образцах древесины использовали молекулярный метод идентификации вида с помоЕ.В. Давиденко щью видоспецифичных праймеров. Экстракцию ДНК проводили вышеописанным методом с использованием СТАВ буфера. Образы предварительно высушивали с помощью лиофильной сушки в течение 48 часов.

Амплификацию с помощью ПЦР проводили с использованием видоспецифичных праймеров CHA-F1 (GGTTTCACTCCTGAACAACGA) и CHA-R2 (GACCCTATCGCGAGAAGAATTA), разработанными для идентификации H. fraxineus. ПЦР проводилась вышеописанными методами при температуре отжига 60 °С [Johansson et al., 2009, Gross et al., 2012]. Электрофорез и визуализацию результатов проводили, как описано выше.

Данные обработаны статистически с использованием пакета программ Statgraphics for Windows 7.0. В статье обсуждаются величины, достоверно различающиеся при Р 0,05.

Результаты и обсуждение. Санитарное состояние ясеневых насаждений в Украине ухудшилось с 2006 г., когда площадь усыхающих насаждений составила 3,4 тыс. га [Давиденко и др., 2013, Мешкова и др., 2013].

Усыхающие ясеневые насаждения обнаружены в разных природных зонах Украины. Так, в Винницкой области усохло 817,1 га ясеневых насаждений, в Черкасской 659 га, в Николаевской 764 га, в Херсонской 495,7 га, в Луганской 212,9 га [Мешкова и др., 2013].

Нами были проведены обследования в смешанных насаждениях ясеня возрастом 15–60 лет с преобладанием ясеня. На всех пробных площадях был представлен только ясень обыкновенный.

По результатам обследования был определен средний балл (индекс) жизненного состояния древостоев ясеня. По величине индекса состояния древостои классифицировали на здоровые (с индексом 1,0–1,5), ослабленные (1,6–2,5), сильно ослабленные (2,6–3,5), отмирающие (3,6–4,5) и сухостойные ( 4,6). Результаты обследований за последние 4 года представлены в табл. 1.

Таблица 1 Оценка состояния насаждений ясеня в центральной и восточной частях Украины (2011–2014 гг.)

–  –  –

При анализе образцов древесины, помещенных на агаровую среду Хагема после стерилизации, авторы наблюдали начало роста мицелия C. fraxinea через 14–20 дней. Также авторами было отмечено, что рост мицелия C. fraxinea на агаровой среде Хагема с добавлением свежих листьев и побегов происходит значительно быстрее. Так, одинакового размера (75 % площади чашки Петри с диаметром 100 мм) колонии гриба на среде с листьями ясеня достигали в 1,8–2,6 раза быстрее.

При изолировании C. fraxinea из некротических тканей пораженной древесины ясеня, авторы выделили основные симптомы формирования колоний, которые значительно отличались по цвету, темпу роста и взаимодействию с другими колониями грибов. C. fraxinea продуцирует белые колонии с тонкими ответвлениями, мицелий, равномерно белый или белый, с серыми пятнами или секторами (см. рисунок). Наиболее часто встречаются пушистые колонии, от белового до оранжевого расцветок или белого с железистых коричневыми пятнами, рассеянными неравномерно по поверхности или сосредоточенными вокруг зоны посева. Некоторые штаммы могут производить железистые коричневые колонии. В основном, буро-коричневые колонии вырастают в течение 4–7 недель при комнатной температуре 23…25 °C (см. рисунок).

Авторы инкубировали интенсивно спорообразующие культуры с светло-серыми краями еще 3 недели при 23…25 °С, а затем перемещали их в холодильник и инкубировали 6 недель при температуре 4 °C. При таком режиме выращивания по краю колоний образуются фиалофоры. Также было замечено, что одним из самых характерных свойств С. fraxinea, является склонность колоний этого гриба к образованию секторов, которые отличались по цвету, структуре воздушного мицелия и темпам роста. Часто, образование многочисленных фиалофор и фиалид было связано с оливковыми, серыми или темно-серыми колониями.

Различные типы колоний C. fraxinea, при инкубировании на солодовом агаре в течение 5 недель с началом споруляции по краям колоний [Kowalski, Bartnik, 2010] Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211 В результате проведенной работы нами было получено 468 колоний грибов, которые были распределены на морфотипы по морфологическим признакам. Из них 139 колоний были чистые культуры гриба С. fraxinea.

Другая часть была определена до вида/рода с помощью микроскопа, остальные были использованы для ПЦР и последующего определения методом сравнения полученных последовательностей с базой данных. Результаты показаны в табл. 2.

Как видно из табл. 2, наиболее часто во всех образцах некрозов ясеня встречается патоген H. fraxineus (78,7 %), а также Cladosporium tenuissimum (37,8 %) и Hysterographium fraxini (22,8 %).

Если рассматривать по регионам, то в этом случае также безусловно доминирует H. fraxineus практически с одинаковой с частотой встречаемости – 78,3, 77,2 и 77,6 % для Сумской, Харьковской и Житомирской областей. При этом в Сумской обл. также достаточно часто встречается C. tenuissimum и Sordaria sp. (51,9 и 36,4 % соответственно). Следует отметить, что для Харьковской обл. почти все виды встречаются гораздо реже, а наряду с H. fraxineus (77,2 %), лидируют Sordaria sp. (15,2 %), а также Fusarium sp. и C. tenuissimum с одинаковой частотой встречаемости (13 %).

Распространенность почти всех грибных видов была наибольшей в образцах, собранных в Житомирской обл., а наиболее распространенными видами в этой области после H. fraxineus были C. tenuissimum и H. fraxini с одинаковой встречаемостью 44,9 %.

В стволах и ветвях ослабленных деревьев ясеня были обнаружены короеды Hylesinus crenatus F. и Hylesinus varius F.

Также необходимо отметить, что некоторые страны Европы, с 10-летней и более историей болезни, создали проекты по стратегии управления этим заболеванием в лесных, городских и парковых насаждениях. Анализируя базу научных публикаций по проблеме усыхания ясеня Web of Science и данные официального сайта международного проекта FRAXBACK «Усыхание ясеня в Европе: разработка стратегии устойчивого ведения лесного хозяйства» (The FRAXBACK COST action «Understanding Fraxinus dieback in Europe and elaborating guidelines for sustainable management» http://www.fraxback.eu/), авторы выяснили, что многие европейские страны создали ряд практических рекомендаций. Поскольку H. fraxineus – инвазивный патоген, основные принципы практических рекомендаций были идентичны для большинства инвазивных патогенов и направлены на обеспечение сохранения биологического разнообразия видов, связанных с ясеневыми насаждениями и поддержание генетического разнообразия деревьев ясеня.

Е.В. Давиденко Так, основные рекомендации лесной комиссии Великобритании (Chalara dieback of ash – management of ash leaves and saplings, Forestry Commission, 2014: http://www.forestry.gov.uk/forestry/infd-92gjvb) сводятся к мероприятиям по ведению лесного хозяйства в ясеневых насаждениях, которым угрожает распространение болезни усыхания ясеня. Все мероприятия должны быть направлены на выращивание здоровых и относительно устойчивых деревьев. Рекомендовано уделять внимание повышению генетического и возрастного разнообразия насаждений, поскольку использование фунгицидов для защиты от болезни не обеспечивает защитного эффекта, а возбудитель быстро размножается в молодых растениях.

Учитывая сведения о наследовании устойчивости деревьев к возбудителю, следует способствовать развитию естественного возобновления из семян устойчивых деревьев, которые остались в очаге болезни [Queloz et al., 2014]. Также отмечено, что инфицированные городские деревья-ветераны ясеня не следует вырубать, так как они выполняют экологическую и социальную функцию, позволяют поддерживать биоразнообразие в населенных пунктах за счет других видов, связанных с этой породой. Целесообразно осуществлять обрезку пораженных ветвей таких деревьев для поддержания их эстетического вида.

Выводы

1. Последние 10 лет в Украине происходит ухудшение санитарного состояния ясеня обыкновенного, связанное с действием совокупности биотических (вредные насекомые, болезни), абиотических (погодные условия) и антропогенных (хозяйственная деятельность) факторов.

2. Быстрое распространение новой болезни ясеня в 25 странах Европы свидетельствует о возможности изменения состава пород в ближайшие годы. На востоке Украины за последние годы распространенность патогена в пораженных насаждениях увеличилась с 5,6 % (2011 г.) до 78,3 % (2014 г.).

Стремительное увеличение доли ясеня, пораженного H. fraxineus, свидетельствует о возможном развитии в Украине литовского или польского сценария усыхания ясеня и резкое уменьшение доли ясеня в лиственных лесах, парках и лесополосах. Основными симптомами болезни является постепенное отмирание крон, некрозы ствола, побегов, листьев, обесцвечивание древесины и листьев. Из других патогенов, наиболее распространенным в усыхающих насаждениях ясеня, был Hysterographium fraxini (22,8 % всех образцов с некрозами тканей).

3. Идентификацию патогена H. fraxineus возможно проводить по морфологическим симптомам усыхания, подтверждая методом выделения Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211 гриба в чистую культуру из образцов некрозов ясеня, используя среду Хагема с добавлением листьев и побегов ясеня. Быстрая идентификация возможна молекулярными методами, основанными на проведении ПЦР с видоспецифическими праймерами.

4. Опыт стран Европы относительно массового усыхания ясеня свидетельствует о необходимости уделить внимание мониторингу распространения болезни на Украине и в сопредельных странах и изучению особенностей восприимчивости отдельных популяций и генотипов ясеня к H. fraxineus.

Библиографический список Давиденко К.В., Мєшкова В.Л.,Кузнєцова Т.Л. Поширення Hymenoscyphus pseudoalbidus – збудника всихання ясена у лівобережній Україні // Лісівництво і агролісомеліорація : зб. наук. праць. 2013. Вип. 123. С. 143–150.

Мешкова В.Л., Давиденко Е.В. Насекомые и возбудители болезней ясеня на востоке Украины // Современное состояние и перспективы охраны и защиты лесов в системе устойчивого развития: матер. Междунар. науч.-практ. конф. (Ин-т леса НАН Беларуси, Гомель, Беларусь, 9–11 октября 2013 г.). Гомель, 2013.

С. 96–100.

Мєшкова В. Л., Давиденко К.В., Бережненко Ж.І. Комахи-листогризи на ясені (Fraxinus sp.) у зелених насадженнях Харківщини // Захист рослин у ХХІ ст.: проблеми та перспективи розвитку: матеріали міжнар. наук. конф. студ., аспірантів і молодих учених. Х.: ХНАУ, 2013. С.71–74.

Шабунин Д.А., Семакова Т.А., Давиденко Е.В., Васаитис Р.А. Усыхание ясеня на территории памятника природы «Дудергофские высоты», вызванное грибом Hymenoscyphus pseudoalbidus, и морфологические особенности его аскоспор // Труды Санкт-Петербургского НИИ лесного хозяйства. 2012. № 1–2. С. 70–79.

Baral1 H. O., Queloz V., Hosoya T. Hymenoscyphus fraxineus, the correct scientific name for the fungus causing ash dieback in Europe // IMA Fungus, 2014, vol. 5(1), pp. 79–80.

Bengtsson S.B.K. Dieback of Fraxinus excelsior Biology of Ash Dieback and Genetic Variation of the Fungus Hymenoscyphus pseudoalbidus Doctoral Thesis Swedish University of Agricultural Sciences. Uppsala, 2013. 51 р.

Cleary M. R., Daniel G., Stenlid J. Light and scanning electron microscopy studies of the early infection stages of Hymenoscyphus pseudoalbidus on Fraxinus excelsior // Plant Pathology, 2013, vol. 62(6), pp. 1294–1301.

Davydenko K. Vasaitis, R., Stenlid J., Menkis A. Fungi in foliage and shoots of Fraxinus excelsior in eastern Ukraine: a first report on Hymenoscyphus pseudoalbidus // For. Path, 2013, vol. 43, pp. 462–467.

Davydenko K., Meshkova V. European ash (Fraxinus excelsior) dieback – situation in Europe and Ukraine // Лісове і садово-паркове господарство (електронне наукове видання), 2014, no. 5.

Е.В. Давиденко Gross A., Holdenrieder O., Pautasso M., Queloz V., Sieber T.N. Hymenoscyphus pseudoalbidus, the causal agent of European ash dieback // Molecular Plant Pathology, 2014, vol. 15(1), pp. 5–21.

Gross A., Grnig, C. R., Queloz V., Holdenrieder O. A molecular toolkit for population genetic investigations of the ash dieback pathogen Hymenoscyphus pseudoalbidus // Forest Pathology, 2012, vol. 42, pp. 252–264.

Gross A., Zaffarano P. L., Duo A., Grnig C. R. Reproductive mode and life cycle of the ash dieback pathogen Hymenoscyphus pseudoalbidus // Fungal Genet. Biology, 2012, vol. 49, pp. 977–986.

Ioos R., Kowalski T., Husson C., Holdenrieder O. Rapid in plant detection of Chalara fraxinea by a real-time PCR assay using a dual-labelled probe // European J.

Plant Pathology, 2009, vol. 125, pp. 329–335.

Johansson S. B. K., Vasaitis R, Ihrmark K., Barklund P., Stenlid J. Detection of Chalara fraxinea from tissue of Fraxinus excelsior using species-specific ITS primers // Forest Pathology, 2009, vol. 40, pp. 111–115.

Kowalski T. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in Poland // Forest Pathology, 2006, vol. 36, pp. 264–270.

Kowalski T. Holdenrieder O. Pathogenicity of Chalara fraxinea // Forest Pathology, 2009, vol. 39, pp. 1–7.

Kowalski T., Bartnik C. Morphologial variation in colonies of Chalara fraxinea isolated from ash (Fraxinus excelsior L.) stems with symptoms of dieback and effects of temperature on colony growth and structure // Acta Agrobotanica, 2010, vol. 63, no. 1, pp. 99–106.

Pautasso M., Aas G., Queloz V., Holdenrieder O. European ash (Fraxinus excelsior) dieback–a conservation biology challenge // Biol. Conserv, 2013, vol. 158, pp. 37–49.

Queloz V., Grnig C. R., Berndt R., Kowalski T., Sieber T. N., Holdenrieder O. Cryptic speciation in Hymenoscyphus albidus // Forest Pathology, 2011, vol. 41, pp. 133–142.

Zhao Y.-J., Hosoya T., Baral H.-O., Hosaka K., Kakishima M. Hymenoscyphus pseudoalbidus, the correct name for Lambertella albida reported from Japan // Mycotaxon, 2012, vol. 122, pp. 25–41.

Bibliography

Davidenko K.V., Mєshkova V.L.,Kuznєtsova T.L. Poshirennia Hymenoscyphus pseudoalbidus – zbudnika vsikhannia iasena u lіvoberezhnіi Ukraїnі. Lіsіvnitstvo і agrolіsomelіoratsіia : zb. nauk. prats'. 2013. Vip. 123. S. 143–150.

Meshkova V.L., Davidenko E.V. Nasekomye i vozbuditeli boleznei iasenia na vostoke Ukrainy. Sovremennoe sostoianie i perspektivy okhrany i zashchity le-sov v sisteme ustoichivogo razvitiia: mater. Mezhdunar. nauch.-prakt. konf. (In-t lesa NAN Belarusi, Gomel', Belarus', 9–11 oktiabria 2013 g.). Gomel', 2013. S. 96–100. (Rus) Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211 Mєshkova V. L., Davidenko K.V., Berezhnenko Zh.І. Komakhi-listogrizi na iasenі (Fraxinus sp.) u zelenikh nasadzhenniakh Kharkіvshchini.

Zakhist roslin u KhKhІ st.:

problemi ta perspektivi rozvitku: materіali mіzhnar. nauk. konf. stud., aspіrantіv і molodikh uchenikh. Kh.: KhNAU, 2013. S.71–74.

Shabunin D.A., Semakova T.A., Davidenko E.V., Vasaitis R.A. Usykhanie iasenia na territorii pamiatnika prirody «Dudergofskie vysoty», vyzvannoe gribom Hymenoscyphus pseudoalbidus, i morfologicheskie osobennosti ego askospor. Trudy Sankt-Peterburgskogo NII lesnogo khoziaistva. 2012. № 1–2. S. 70–79. (Rus) Baral1 H. O., Queloz V., Hosoya T. Hymenoscyphus fraxineus, the correct scientific name for the fungus causing ash dieback in Europe. IMA Fungus, 2014, vol. 5(1), pp. 79–80.

Bengtsson S.B.K. Dieback of Fraxinus excelsior Biology of Ash Dieback and Genetic Variation of the Fungus Hymenoscyphus pseudoalbidus Doctoral Thesis Swedish University of Agricultural Sciences. Uppsala, 2013. 51 р.

Cleary M. R., Daniel G., Stenlid J. Light and scanning electron microscopy studies of the early infection stages of Hymenoscyphus pseudoalbidus on Fraxinus excelsior. Plant Pathology, 2013, vol. 62(6), pp. 1294–1301.

Davydenko K. Vasaitis, R., Stenlid J., Menkis A. Fungi in foliage and shoots of Fraxinus excelsior in eastern Ukraine: a first report on Hymenoscyphus pseudoalbidus.

For. Path, 2013, vol. 43, pp. 462–467.

Davydenko K., Meshkova V. European ash (Fraxinus excelsior) dieback – situation in Europe and Ukraine. Лісове і садово-паркове господарство (електронне наукове видання), 2014, no. 5.

Gross A., Holdenrieder O., Pautasso M., Queloz V., Sieber T.N. Hymenoscyphus pseudoalbidus, the causal agent of European ash dieback. Molecular Plant Pathology, 2014, vol. 15(1), pp. 5–21.

Gross A., Grnig, C. R., Queloz V., Holdenrieder O. A molecular toolkit for population genetic investigations of the ash dieback pathogen Hymenoscyphus pseudoalbidus. Forest Pathology, 2012, vol. 42, pp. 252–264.

Gross A., Zaffarano P. L., Duo A., Grnig C. R. Reproductive mode and life cycle of the ash dieback pathogen Hymenoscyphus pseudoalbidus. Fungal Genet. Biology, 2012, vol. 49, pp. 977–986.

Ioos R., Kowalski T., Husson C., Holdenrieder O. Rapid in plant detection of Chalara fraxinea by a real-time PCR assay using a dual-labelled probe. European J.

Plant Pathology, 2009, vol. 125, pp. 329–335.

Johansson S. B. K., Vasaitis R, Ihrmark K., Barklund P., Stenlid J. Detection of Chalara fraxinea from tissue of Fraxinus excelsior using species-specific ITS primers.

Forest Pathology, 2009, vol. 40, pp. 111–115.

Kowalski T. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in Poland. Forest Pathology, 2006, vol. 36, pp. 264–270.

Kowalski T. Holdenrieder O. Pathogenicity of Chalara fraxinea. Forest Pathology, 2009, vol. 39, pp. 1–7.

Е.В. Давиденко Kowalski T., Bartnik C. Morphologial variation in colonies of Chalara fraxinea isolated from ash (Fraxinus excelsior L.) stems with symptoms of dieback and effects of temperature on colony growth and structure. Acta Agrobotanica, 2010, vol. 63, no. 1, pp. 99–106.

Pautasso M., Aas G., Queloz V., Holdenrieder O. European ash (Fraxinus excelsior) dieback–a conservation biology challenge. Biol. Conserv, 2013, vol. 158, pp. 37–49.

Queloz V., Grnig C. R., Berndt R., Kowalski T., Sieber T. N., Holdenrieder O. Cryptic speciation in Hymenoscyphus albidus. Forest Pathology, 2011, vol. 41, pp. 133–142.

Zhao Y.-J., Hosoya T., Baral H.-O., Hosaka K., Kakishima M. Hymenoscyphus pseudoalbidus, the correct name for Lambertella albida reported from Japan.

Mycotaxon, 2012, vol. 122, pp. 25–41.

Давиденко Е.В. Основные причины массового усыхания ясеня в центральных и восточных областях Украины // Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211. С. 147–160.

Приведены данные ухудшения санитарного состояния ясеневых насаждений на Украине и изучены основные причины усыхания ясеня на пробных площадях в трех центральных и восточных областях Украины. Основная причина усыхания ясеня – это болезнь, вызываемая грибом Hymenoscyphus fraxineus (анаморфа Chalara fraxinea). Болезнь в настоящее время известна в более чем 25 странах Европы. Молекулярными методами подтверждено наличие возбудителя болезни в Харьковской, Сумской и Житомирской областях в 78,3 % образцах побегов с некрозами. Основными симптомами болезни являются постепенное отмирание крон, некротические пятна на коре побегов, листьев, ствола, обесцвечивание древесины. Изучены методы идентификации возбудителя и изложены рекомендации европейских исследователей по предупреждению отрицательных последствий распространения болезни для лесного хозяйства и лесных экосистем.

К л ю ч е в ы е с л о в а : фитопатогены, ясень, усыхание, Hymenoscyphus fraxineus, Chalara fraxinea, Fraxinus.

Davydenko K. The main causes of ash dieback for Central and East part of Ukraine. Izvestia Sankt-Peterburgskoj Lesotehniceskoj Akademii, 2015, is. 211, pp. 147–160 (in Russian with English summary).

Ash dieback is an emerging infectious disease caused by the ascomycete fungus Hymenoscyphus fraxineus (anamorph Chalara fraxinea), currently spreading in Europe, inclusive of Ukraine. The authors' own data on ash dieback, caused by H. fraxineus are reviewed for 12 monitoring plots in three Ukrainian regions. Disease is known now in over 25 countries of Europe. The presence of pathogen in Kharkiv, Sumy, and Zhytomyr regions is proved by molecular methods. The main symptoms of disease are: quick successive crown dieback, necrotic spots on the bark of shoots, Известия Санкт-Петербургской лесотехнической академии. 2015. Вып. 211 discoloration of wood and leaves, leaf necrosis, stem necroses. The present study was focused on investigation of identification pathogen,using both morphological and molecular methods as well as on development the guidelines for prevention of negative consequences of disease spread for forest management and forest ecosystems.

K e y w o r d s : forest disease, ash dieback, Hymenoscyphus fraxineus, Chalara fraxinea, Fraxinus.

ДАВИДЕНКО Екатерина Валерьевна – Украинский ордена «Знак Почета»

научно-исследовательский институт лесного хозяйства и агролесомелиорации им.

Г.Н. Высоцкого, кандидат сельскохозяйственных наук. SPIN-код: 1289-8697.

61024, ул. Пушкинская, д. 86, г. Харьков, Украина. E-mail: Kateryna.davy denko@yandex.ua, davidenkoKV@mail.ru DAVYDENKO Ekateryna V. – PhD (Agriculture), Ukrainian honored with «Znak Poshany» Research Institute of Forestry and Forest Melioration named after G.N. Vysotsky. SPIN code: 1289-8697.

61024. Pushkinska str. 86, Kharkov. Ukraine. E-mail: Kateryna.davydenko

Похожие работы:

«СОЦИОЛОГИЧЕСКОЕ ОБОЗРЕНИЕ. Т. 10. № 1-2.эссе статьи и 2011 Развивая теорию событий. Статья первая. Дидактический эксперимент Александр Филиппов* Аннотация. Теория социальных событий является новой попыткой созда...»

«1.1.1.1 Введение в регрессионный анализ Регрессионный анализ остается одной из наиболее востребованных и популярных количественных методов в социальных науках. Возможность одновременного изучения неограниченного количества объектов, а также...»

«Шелдон Натенберг Опционы: Волатильность и оценка стоимости. Стратегии и методы опционной торговли Текст предоставлен издательством http://www.litres.ru/pages/biblio_book/?art=5313514 Опционы: Волатильность и оце...»

«Ф.Равдоникас. Логарифмический счёт в традиционной нотации // Серия Проблемы музыкознания, вып. 2; Аспекты теоретического музыкознания. Сборник научных трудов, Л., 1989, с. 44-50. Наша музыкальная офрография ос...»

«Предисловие 1. Разработка торговых стратегий 13 1.1. Философия построения торговых стратегий: научный и эмпирический подходы 14 1.2. Рациональный подход к построению торговых стратегий 16 1.3. Особенност...»

«КРУММЕЛЬ И. В. — в ПКК КРУММЕЛЬ Иосиф Викентьевич, родился в 1872 в Бердичеве Винницкой губ. Окончил Житомирскую духовную семинарию, в 1899 — рукоположен. С 1902 — администратор прихода в поселке Млинов Дубненского деканата, с 1904 — в сел...»

«СОВРЕМЕННОЕ СОСТОЯНИЕ И ТЕНДЕНЦИИ РАЗВИТИЯ РЫНКА ПРОДОВОЛЬСТВЕННЫХ ТОВАРОВ УДК 339.13:664.66 Н.А. Батурина, Ю.И. Лукомская СОВРЕМЕННЫЕ ТЕНДЕНЦИИ РАЗВИТИЯ РЫНКА ХЛЕБОБУЛОЧНЫХ ИЗДЕЛИЙ В статье рассмотрен...»

«Вестник Тюменского государственного университета. Гуманитарные исследования. Humanitates. 2015. Том 1. № 4(4)83-92 © Н. Г. КАНТЫШЕВА Тюменский государственный университет nkantyscheva_@mail.ru УДК 81’371 ДЕ...»

«ЗАКОН ПРИМОРСКОГО КРАЯ ОБ ИСПОЛЬЗОВАНИИ ЛЕСОВ В ПРИМОРСКОМ КРАЕ Принят Законодательным Собранием Приморского края 26 сентября 2007 года Настоящий Закон в соответствии с Конституцией Российской Федерации, Лесным кодексом Российской Федерации регулирует порядок использования лесов в Приморском крае в целях з...»

«ГОСТ P ИСО 10011-2-93 Группа Т58 ГОСУДАРСТВЕННЫЙ СТАНДАРТ РОССИЙСКОЙ ФЕДЕРАЦИИ РУКОВОДЯЩИЕ УКАЗАНИЯ ПО ПРОВЕРКЕ СИСТЕМ КАЧЕСТВА Часть 2. Квалификационные критерии для экспертов-аудиторов Guidelines for auditing quality systems. Part 2: Qualificati...»





















 
2017 www.pdf.knigi-x.ru - «Бесплатная электронная библиотека - разные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.