WWW.PDF.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Разные материалы
 

Pages:   || 2 | 3 | 4 |

«МАТЕРИАЛЫ XLI МЕЖДУНАРОДНОЙ НАУЧНОЙ СТУДЕНЧЕСКОЙ КОНФЕРЕНЦИИ «Студент и научно-технический прогресс» БИОЛОГИЯ Новосибирск УДК 54 ББК Г.я 431 Материалы ХLI Международной научной студенческой ...»

-- [ Страница 1 ] --

МИНИСТЕРСТВО ОБРАЗОВАНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ

СИБИРСКОЕ ОТДЕЛЕНИЕ РОССИЙСКОЙ АКАДЕМИИ НАУК

НОВОСИБИРСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ

МАТЕРИАЛЫ

XLI МЕЖДУНАРОДНОЙ

НАУЧНОЙ СТУДЕНЧЕСКОЙ КОНФЕРЕНЦИИ

«Студент и научно-технический прогресс»

БИОЛОГИЯ

Новосибирск УДК 54 ББК Г.я 431 Материалы ХLI Международной научной студенческой конференции «Студент и научно-технический прогресс»: Биология / Новосиб. гос. университет. Новосибирск, 2003. с.

Конференция проведена при поддержке Федеральной целевой программы «Интеграция наук

и и высшего образования России на 2002–2006 гг.», президиум Сибирского отделения Российской академии наук.

Редакционная коллегия Председатель – д-р биол. наук, проф. М.Г. Сергеев Зам. председателя – канд. хим. наук, доц. Л.М. Халимская Члены бюро: д-р биол. наук, проф. Ж.И. Резникова, канд. биол. наук, доц. З.И. Гладкова, канд. биол. наук, доц. Л.Б. Пшеницына, инж. И.А. Ванькова, д-р биол. наук, проф.Г.М. Дымшиц, канд. биол. наук О.И. Синицына, д-р биол. наук, проф. Л.Ф. Гуляева, канд. биол. наук И.В. Морозов, д-р биол. наук Н.В. Вольф, канд. биол. наук И.З. Плюснина, О.А. Шварева, д-р биол. наук, проф. И.К. Захаров, канд. биол. наук, доц. Н.А. Попова © Новосибирский государственный университет, 2002



ЦИТОЛОГИЯ И ГЕНЕТИКА

МУТАЦИИ В ГЕНЕ SYNTAXIN-13 НАРУШАЮТ КЛЕТОЧНОЕ

ДЕЛЕНИЕ У DROSOPHILA MELANOGASTER

С.М. Аташева, Е.С. Решетникова Новосибирский государственный университет, Институт цитологии и генетики СО РАН, г. Новосибирск Синтаксины – трансмембранные белки, играющие важную роль в везикулярном транспорте и процессе слияния мембран в клетке. Гены, кодирующие синтаксины, высококонсервативны и найдены у всех эукариот.

Для белков этого семейства характерно наличие трех доменов: консервативного С-концевого, закрепляющего белок в мембране; вариабельного Nконцевого, который узнается регуляторными белками; и домена, отвечающего за образование комплекса, необходимого для слияния мембран.

У Drosophila melanogaster изучены только продукты генов syntaxin-1А и syntaxin-5, а остальные девять представителей этого семейства предсказаны с помощью компьютерного анализа, их предположительные функции основаны на гомологии с синтаксинами млекопитающих. SYX1А дрозофилы необходим для процесса целлюляризации – особого типа цитокинеза в раннем эмбриогенезе дрозофилы, SYX5 принимает участие в цитокинезе мейоза самцов.

Компьютерно-предсказанный ген syntaxin-13 D. melanogaster локализован в районе 69F6 хромосомы 3. Для изучения тканеспецифичности экспрессии гена syntaxin-13 была использована Р-элементная инсерция транспозона P{ry+t7.2=PZ}, содержащего репортерный ген бета-галактозидазы, которая локализована в первом некодирующем экзоне гена syx13. Нами показано, что экспрессия репортерного гена активируется, начиная с 9-10-й стадии развития эмбриона, во всех сегментах с дорзальной стороны, при этом наиболее активное окрашивание выявляется в переднем и заднем полюсах. На личиночной стадии экспрессия репортерного гена наблюдалась во внешних пролиферативных центрах оптических долей нервных ганглиев, в крыловых имагинальных дисках - в группе клеток на границе крыло-нотум, в глазном имагинальном диске – в клетках за морфогенетической бороздой, в ножных имагинальных дисках - в виде центрального “пунктирного кольца”. У имаго окраска выявляется в некоторых районах семенников, по-видимому, соответствующих цистам.





Нами выявлено, что инсерция Р-элемента в первый некодирующий экзон гена syx13 вызывает гибель гомозиготных особей на стадии куколки. В клетках нервных ганглиев личинок третьего возраста, гомозиготных по syx13, наблюдается неравномерная конденсация хромосом, с низкой частотой встречается нерасхождение хромосом в анафазе, в том числе монополярные анафазы. У мутантных личинок нарушена продолжительность стадий митоза: на стадии профазы у гомозигот по syx13 находится 30 % клеток, а у личинок дикого типа Hikone AW – 18 % клеток, на стадии анафазы – 15 и 5 % соответственно. В семенниках, выделенных из куколок, гомозиготных по syx13, нами выявлены следующие аномалии: неравномерная конденсация хромосом, высокая частота нерасхождения хромосом и, как следствие, появление анеуплоидных мейоцитов, хромосомные мосты в анафазе и телофазе, нарушение цитокинеза и спермиогенеза.

Следующей задачей работы было создание трансгенных особей, экспрессирующих ген syntaxin-13 в Gal4-UAS-системе. Известно, что введение в клетку экзогенной ДНК, содержащей модифицированную копию синтаксина, приводило к нарушению функций нативного белка. Мы применили аналогичный подход и получили гибридную конструкцию, которая содержит модифицированную кДНК гена syntaxin-13, кодирующую полипептид, укороченный с N-конца на 47 аминокислот. Предполагается, что синтаксин-13 при повреждении N-концевого домена не опознается другими белками, что приводит к нарушению его функций.

Научный руководитель – канд. биол. наук С.А. Федорова

СТРУКТУРА ПОПУЛЯЦИИ СКОРОСПЕЛОЙ МЯСНОЙ ПОРОДЫ

СВИНЕЙ ПО АЛЛОТИПАМ НЕКОТОРЫХ СИСТЕМ

СЫВОРОТОЧНЫХ БЕЛКОВ

–  –  –

В течение многих лет селекционеры пытаются маркировать признаки продуктивности животных. В качестве маркеров используют группы крови, аллотипы сывороточных белков, ДНК. Целью наших исследований было изучение структуры популяции скороспелой мясной породы свиней по системам альфа-макроглобулинов (аллотипы АМ1, АМ2 и АМ5), липопротеинов высокой (Lpr1) и низкой плотности (LpB3, LpB12), гаммаглобулинов (IgG2b). Исследования проведены в племрепродукторе учхоза «Тулинское» на молодняке свиней создаваемого новосибирского типа СМ-1. Типирование проводилось стандартным методом двойной иммунодиффузии в 1,2 %-м геле агара по Оухтерлони, на базе лаборатории разведения экспериментальных животных Института цитологии и генетики СО РАН. Обнаружено полное отсутствие среди исследованных особей (n = 82) носителей аллеля LpB3. Частота встречаемости аллотипа LpB12 составила 98 %, что выше, чем в крупной белой, ландрас и кемеровской породах.

Частота аллотипа АМ1 возросла за несколько лет с 10 % до 25 %. Частота встречаемости аллеля IgG2b в 2001 г. составила 83 %, что также выше, чем у большинства культурных пород свиней, и примерно соответствует кемеровской породе, родственной СМ-1.

Научный руководитель – канд. биол. наук, доц. К.В. Жучаев

ИЗМЕНЕНИЯ ВЯЗКОСТИ МЕМБРАН ЭРИТРОЦИТОВ

В УСЛОВИЯХ РАЗВИТИЯ КАНЦЕРОГЕНЕЗА

–  –  –

Клеточная мембрана – мишень для действия любых факторов в норме и при патологии. В опухолевых клетках происходит нарушение физикохимических свойств мембраны. Продукты секреции опухолевых клеток действуют угнетающе на многие здоровые органы и ткани и приводят к развитию паранеопластического синдрома. Зачастую летальный исход в послеоперационный период связан с интоксикацией организма продуктами жизнедеятельности опухолевых клеток. В связи с этим становится актуальной проблема исследования структурно-функциональных изменений в различных органах и тканях у онкологических больных. Ключевая роль в регуляции всех процессов в клетке принадлежит ферментам и рецепторам мембраны, интегральным показателем которой является ее текучесть. Целью нашей работы явилось изучение текучести мембран эритроцитов. Исследования проводились на эритроцитах 16 онкологических больных; контрольную группу составляли 14 условно здоровых человек. Оценку относительной микровязкости мембран клеток крови осуществляли методом латеральной диффузии гидрофобного зонда пирена (С16Н10). Интенсивность флюоресценции пирена определяли на спектрофлуориметре AMINCO BOWMAN Siries2. Относительная микровязкость мембран эритроцитов в зоне липидного бислоя в контрольной группе составила 1,5 ± 0,3, а в зоне белок-липидного контакта – 2,4 ± 0,4, в то время как у больных раком в зоне липидного бислоя и в зоне белок-липидного контакта коэффициент экзимеризации был равен 1,0 ± 0,1 и 1,4 ± 0,2 соответственно.

Таким образом, текучесть мембраны эритроцитов у онкологических больных по сравнению с эритроцитами здоровых людей снижена как в зоне липидного бислоя (на 33 %), так и в зоне белок-липидного контакта (на 41 %). Такое изменение текучести мембраны эритроцитов должно вызывать нарушение функций эритроцитов, что обусловливается ухудшением их способности к деформации. Таким образом, подобные структурнофункциональные изменения эритроцитов у онкологических больных неизбежно будут приводить к гипоксии различных органов и тканей.

–  –  –

Одной из актуальных задач современной генетики является изучение путей регуляции морфогенеза. Целью данной работы было выявление роли генов fat (ft), dumpy (dp) и Merlin (Mer) в развитии крыловых имагинальных дисков (КИД) Drosophila melanogaster. Ген ft, мутации которого приводят к разрастаниям всех имагинальных дисков, кодирует белок кадгерин, локализующийся в адгезивных клеточных контактах; dp кодирует фибриллинподобную молекулу, участвующую в формировании базальных клеточных контактов; продукт Mer, вероятно, участвует в формировании как адгезивных, так и щелевых клеточных контактов. В работе была использована и мутация гена apterous (ар), кодирующего транскрипционный фактор, который играет ключевую роль в обособлении дорсального и вентрального компартментов КИД и экспрессируется в дорсальном компартменте.

У личинок aprk568 dp / aprk568 ft4 выявлены нарушения целостности дорсовентральной границы КИД, десинхронизация развития КИД по сравнению с остальными имагинальными дисками (значительное отставание). У личинок dp aprk568 / dp в ряде случаев обнаружены незначительные нарушения дорсовентральной границы. У дигомозигот dp aprk568 присутствуют те же нарушения дорсовентральной границы, что и у aprk568 dp / aprk568 ft4, но в 50 % КИД выявлены дубликации центральной зоны, соответствующей крылу имаго. Можно сделать вывод о взаимодействии генов dp и ap.

У личинок ft4 aprk568 / ft4 в 90 % КИД обнаружены полные или частичные дубликации вентрального и части дорсального компартментов. В ряде случаев по экспрессии ар выявлено возникновение второй дорсовентральной границы. У дигомозигот ft4 aprk568- дубликации выражены слабо. Наличие дубликаций подтверждено по возникновению двух переднезадних границ КИД. У личинок Mer4/Y по морфологическим особенностям выявлены дубликации как центральной, так и проксимальной зон КИД, соответствующих крылу и дорсальному нотуму имаго (в сумме около 15 % случаев).

Нарушения клеточных контактов, вызванные мутациями трех исследованных генов, приводят к возникновению морфологических нарушений в виде дубликаций КИД, вероятно, за счет нарушения передачи позиционной информации и возникновения центров эктопической экспрессии морфогенов. Такие дубликации всегда возникают в одной и той же определенной зоне на определенной стадии развития КИД в случае каждой мутации.

Спектр дубликаций различных частей КИД в случае Mer4, вероятно, связан с более широкой ролью продукта этого гена в клеточной адгезии.

Научный руководитель – д-р биол. наук Л.В. Омельянчук

АНТАГОНИСТИЧЕСКАЯ АКТИВНОСТЬ БАКТЕРИЙ РОДА

PSEUDOMONAS ПО ОТНОШЕНИЮ К ВОЗБУДИТЕЛЮ ТВЕРДОЙ

ГОЛОВНИ ПШЕНИЦЫ

–  –  –

Ежегодные потери урожая пшеницы от заболевания головней составляют 10-15 %. Целью исследования являлось изучение возможности использования выделенных нами штаммов бактерий рода Pseudomonas для подавления развития твердой головни пшеницы. Всего было проанализировано 190 образцов почвы и сточных вод, из которых выделено девять изолятов с бактериями Pseudomonas. Возможность подавления роста грибов-фитопатогенов проводили чашечным методом на глюкозо-пептонном агаре. Были отобраны 4 наиболее активных штамма бактерий Pseudomonas, которые далее использовались для полевых испытаний для защиты растений пшеницы (сорт жница) от твердой головни. Перед посевом семена пшеницы обрабатывали культуральной жидкостью штаммов Pseudomonas из расчета 106 клеток на одно зерно. Заспорение зерна спорами твердой головни Tilletia caries проводили искусственно из расчета 1–2 г спор на 1 кг зерна с целью создания жесткого инфекционного фона патогена. Культуральную жидкость штаммов Pseudomonas получали путем культивирования при 28 0С в течение 48 часов на среде LB. Титр готовых препаратов составлял 109 клеток/мл. Эффективность препаратов определяли по доле колосьев, пораженных твердой головней в период молочновосковой спелости зерна. Максимум биологической активности отмечен для препарата Pseudomonas pectida, штамм № 17 – число больных колосьев снижается до 40 %.

–  –  –

Виды Aegilops speltoides, A. longissima, A. sharonensis, A. bicornis и A. searsii образуют секцию Sitopsis и являются предполагаемыми донорами В- и G-геномов тетраплоидных (2n=4x=28; AABB или AAGG) и гексаплоидных (2n=6x=42; AABBDD) пшениц.

Данные виды широко используются для внедрения новых хозяйственно-полезных признаков в стабильные генотипы пшеницы. Попытки использования молекулярных маркеров как для выявления конкретного донора В- и G-геномов, так и для молекулярно-генетического картирования генома, анализа гибридных форм с участием видов Aegilops сталкиваются с проблемой гетерогенности исходного материала. Предварительная оценка уровня внутри- и межпопуляционной, а также межвидовой изменчивости различных маркерных систем у видов секции Sitopsis необходима для последующего корректного использования данных маркеров при оценке филогении, проведении молекулярно-генетического картирования и в современных селекционных процессах.

Кроме того, такая оценка позволит судить о важности тех или иных последовательностей ДНК в функционировании и эволюции генома злаковых.

Учитывая популяционную гетерогенность по составу маркеров между видами секции Sitopsis, необходимо провести филогенетический анализ при помощи RAPD-маркеров (Random Amplified Polimorphic DNA) и дать оценку внутривидовой изменчивости субтеломерных повторов у данных линий методами dot-гибридизации и RAPD-анализа.

С помощью RAPD-маркеров (в анализ было взято 300 маркеров) показано отсутствие полиморфизма между индивидуальными растениями в линиях и выявлен внутривидовой полиморфизм. Построенная дендрограмма соответствует известным в литературе представлениям об эволюции данного вида.

Кроме того, растительный геном по сравнению с геномом животных характеризуется более высоким содержанием повторяющихся последовательностей, содержание которых у злаковых составляет, по разным оценкам, от 60 до 95 % геномной ДНК. Семейства повторяющихся последовательностей могут быть либо общими для таксономической группы, либо отличаться у родственных видов структурной организацией и локализацией в геноме. Повторы часто используются в качестве молекулярных маркеров в филогенетических исследованиях. Предварительные исследования диплоидных предшественников (виды Aegilops секции Sitopsis) В-генома гексаплоидных пшениц с помощью молекулярных маркеров показали, что они различаются между собой. Кроме того, они отличаются по ряду морфологических признаков (наличие/отсутствие остей, чувствительность к яровизации). Данные виды имеют также значительные различия по количеству и организации субтеломерных повторов spelt.1 и spelt.52. Нами была показана вариабельность по количеству данных повторяющихся последовательностей между отдельными растениями одной линии, одного вида и между видами. Данная вариабельность в числе копий не коррелирует с филогенией. Однако образование повторяющегося семейства четко связано с процессами дивергенции видов.

Проведен анализ возможных механизмов нестабильности субтеломерных повторов spelt.1 и spelt.52 в популяции A. speltoides.

Научный руководитель – канд. биол. наук Е.А. Салина

ДИВЕРГЕНЦИЯ ПОСЛЕДОВАТЕЛЬНОСТЕЙ EcoRI-ПОВТОРОВ,

ITS2 и 16S У КРИПТИЧЕСКИХ ВИДОВ – A- и B-ФОРМ Anopheles messeae (Diptera, Culicidae)

–  –  –

На основе экологических, цитогенетических и молекулярногенетических данных A- и B-формы малярийного комара Anopheles messeaе можно считать криптическими видами. На молекулярном уровне они дискретно отличаются картиной распределения коротких повторов в EcoRI-гидролизате геномной ДНК: у B-формы выявляется одна фракция повторов длиной около 170 п.н., у A-формы – две (64 и 117 п.н.). Получено и секвенировано по нескольку клонов из каждой фракции повторов, диагностирующих эту пару видов. Гомология однотипных клонов составляет 95–99 %. Все три группы повторов в парных сравнениях (3 комбинации) обнаруживают участки с высокой степенью гомологии. Повторённая последовательность B-формы имеет значительные участки внутренней гомологии. Результаты сравнения свидетельствуют о том, что диагностические последовательности для видов A. messeae имеют общее происхождение: высокомолекулярная фракция могла подразделиться на две низкомолекулярные вследствие возникновения и фиксации в семействе повторов дополнительного EcoRI-сайта, или наоборот. Для А- и В-форм, а также ряда близкородственных видов малярийных комаров проведен анализ нуклеотидных последовательностей 16S и ITS2. Последовательности 16S A- и В-форм не обнаружили дискретных отличий. Другие виды отличались незначительно и имели уникальную последовательность. Обитающий симпатрично с А- и В- формами A. messeae вид A. beklemishevi, цитогенетически далекий от них, оказался наиболее близок к ним по последовательности 16S. При анализе ITS2 A- и B-форм показано, что они отличаются по 5 позициям последовательности. В целом, данные о последовательностях 16S и ITS2 позволили по-новому взглянуть на филогению комаров комплекса A. maculipennis и определить в ней место криптических видов А и В A. messeae.

–  –  –

Проблема оценки генетического риска, связанного с загрязнениями окружающей среды химическими соединениями, обусловлена не только несовершенством знаний о механизме действия мутагенов и особенностями их действия на генетический аппарат, но и необходимостью оценить генетический риск комбинированного эффекта нескольких агентов. Нами были Na2MoO4.H2O, исследованы генотоксические свойства K2Cr2O7,.

Na2WO4 H2O на высших растениях: традесканции клона 02, Crepis capillaris L. и сое (Glycine max (L.) Merill) линии Т219. Генетическая активность этих металлов не изучена. Так как эти металлы составляют VI Б группу, нами была предпринята попытка связать проявление генотоксического потенциала тяжёлых металлов с их положением в Периодической системе химических элементов. По результатам исследований на всех трёх тест-системах установлено понижение генотоксического потенциала в ряду Cr6+ - Mo6+ – W6+, что определяется снижением активности металлов за счёт стабилизации их атомов с увеличением номера периода. Проведённые нами исследования по комбинированному действию солей тяжёлых металлов показали, что реальная картина взаимодействия металлов труднопрогнозируема, так как во многом зависит от свойств компонентов смеси, концентрации, индивидуальной чувствительности и специфичности объектов. Смесь солей Cr6+ и W6+ в сублетальных концентрациях не вызывала комбинированный эффект. Такой эффект выявлен с понижением концентраций до субтоксических, вызывая аддитивность и синергизм для традесканции в концентрациях 10-5–10-6 М. В исследованиях на сое эффекты комбинированного действия не наблюдались. Смесь солей Cr 6+ и Mo6+ дала больший спектр эффектов, во многом зависящий от концентрации раствора. Для традесканции в сублетальной концентрации 10-3 М выявлен антагонизм, при 10-4 М – протекция. На сое при 10-3 М выявлен синергизм, при более низких концентрациях эффекты комбинированного действия не наблюдались. Смесь солей Mo6+ и W6+ на всех выбранных тест-системах вызывала усиление мутагенеза, даже в случаях, когда один или оба компонента по отдельности не проявляли генотоксического эффекта.

Научный руководитель – д-р биол. наук, проф. М.К. Керефова

ДРЕЙФ ГЕНОВ ВО ВНУТРИПОРОДНЫХ ПОПУЛЯЦИЯХ

ДОМАШНИХ СВИНЕЙ

–  –  –

Генетическая дифференциация популяций обусловлена как селективными, так и случайными процессами. У свиней крупной белой породы хорошо выражена внутрипородная подразделенность на локальные популяции. Вот почему на них была проведена оценка компонент межгруппового (межпопуляционного) разнообразия. В работу вошли результаты изучения иммуногенетического полиморфизма по аллотипам свиней крупной белой породы из пяти племзаводов. В сыворотке крови определяли 15 аллотипов шести генетических систем. Гетерогенность популяций оценивали однофакторным дисперсионным комплексом. В качестве градаций фактора выступают популяции, в качестве результативного признака – численности позитивных по аллотипу особей. Определяли общую sy2, факториальную sA2 и случайную se2 вариансы. Достоверность влияния фактора оценивалась критерием Фишера, равенство варианс – критерием Кочрена.

Было обнаружено статистически значимое межгрупповое разнообразие популяций по всем пятнадцати аллотипам. Равенство варианс встречаемости аллотипов показывает, что уровень их изменчивости одинаков, следовательно, можно предположить, что природа их межгрупповой изменчивости одна и та же. В каждом из пяти изученных племзаводов сформировался собственный генофонд, который при внешнем фенотипическом сходстве особей делает каждую популяцию генетически отличной от всех остальных. Популяции свиней одной породы, селекционируемые в одном и том же направлении и одними и теми же методами, по частотам генов, не вовлекаемых явно и непосредственно в селекционный процесс, различаются настолько сильно, что не могут быть отнесены к одной генеральной совокупности. Очевидно, дифференциация изученных внутрипородных популяций вызвана «дрейфом генов».

Научный руководитель – канд. биол. наук, доц. С.П. Князев

ВЛИЯНИЕ УСЛОВИЙ ПРОИЗРАСТАНИЯ НЕКОТОРЫХ

ДИКОРАСТУЩИХ ВИДОВ РАСТЕНИЙ

В РАЙОНАХ ПЕРЕРАБОТКИ НЕФТИ

–  –  –

Целью настоящего исследования является определение генотоксического эффекта загрязнителей, попадающих в окружающую среду при первичной перегонке нефти на мини-заводах и кустарных установках. В качестве объектов исследования взяты два вида растений: ромашка непахучая (Tripleurospermum parviflorum) и конский щавель (Rumex confertus). Семена собраны с территорий, где производилась кустарная переработка нефти (условно загрязненная зона) на расстоянии 4–5 м от подобной установки, и с территорий, где нет такого производства (условно чистая зона). Семена проращивали в термостате при t=260С. Корешки фиксировали в смеси этилового спирта и ледяной уксусной кислоты (3:1) не менее 2–3 час. Материал окрашивали ацетилкармином (2 %-й раствор кармина в 45 %-й ледяной уксусной кислоте) на водяной бане в течение 10–12 мин. Готовили временные давленые препараты. Использовали анателофазный метод на корешках длиной 3-4 см. Проводили анализ не менее 1 тыс. анафаз в четырех повторностях (за повторность считали 10 корешков). Результаты эксперимента показали, что виды, проросшие в условно чистых зонах, дают примерно одинаковый уровень мутагенности – от 1,6 % у ромашки непахучей до 2,4 % у конского щавеля. У этих же видов с условно загрязненной зоны мутагенность резко возрастает: от 7,8 % у конского щавеля до 10,9 % у ромашки непахучей.

Научный руководитель – канд. биол. наук Н.В. Реутова

УЛЬТРАСТРУКТУРНАЯ ДИНАМИКА ЭНДОСИМБИОТИЧЕСКИХ

БАКТЕРИЙ Wolbachia В ПРОЦЕССЕ ГАМЕТОГЕНЕЗА

И ЭМБРИОГЕНЕЗА У ДРОЗОФИЛЫ

–  –  –

Исследование структуры и функции эндосимбиотических бактерий является одним из важных аспектов современной биологии.

Во-первых, показано, что симбионты могут вызывать нарушения в развитии и жизнедеятельности хозяина. Также предполагается возможность происхождения митохондрий и хлоропластов эукариотических клеток от симбиотических бактерий. И, наконец, эндосимбионты открывают широкие возможности для использования их в качестве векторов для переноса генов. С целью изучения возможной функциональной роли эндосимбиотических бактерий Wolbachia в развитии насекомых в данной работе проводился сравнительный анализ их ультраструктуры и распределения в гаметогенезе и эмбриогенезе у сильно инфицированной (Drosophila simulans) и слабо инфицированной (Drosophila melanogaster, линия Canton-S) линий мух. Исследования проводились с помощью методов световой и электронной микроскопии.

В яичниках D. melanogaster и D. simulans бактерии были обнаружены на всех стадиях оогенеза. Во многих случаях они тесно контактировали с мембранами шероховатого эндоплазматического ретикулума, синтезирующего желток, возможно, принимая участие в процессе вителлогенеза.

Семенники D. simulans также были инфицированы бактериями на всех стадиях сперматогенеза. Наблюдалась большая пролиферация Wolbachia на стадии элонгации сперматид во время формирования сократительного аппарата сперматозоида и начала компактизации ядерного материала.

Можно предположить, что эндосимбионты каким-то образом вовлечены в эти процессы.

Изучение эмбрионов D. simulans и D. melanogaster показало, что в интерфазе митоза бактерии локализовались вблизи ядер, а на стадии метафазы и анафазы – у полюсов веретена деления, располагаясь близко к микротрубочкам, что может свидетельствовать об их перемещении внутри эмбриона с помощью цитоскелета. То, что Wolbachia были найдены в полярных клетках эмбрионов, подтверждает ранее полученные данные о вертикальном переносе бактерий через половые клетки. Установлено наличие у бактерий помимо двойной оболочки дополнительной наружной мембраны, что позволяет предполагать их возможное попадание в клетки путём пиноцитоза. Впервые было обнаружено, что Wolbachia в эмбрионах D. simulans могут образовывать структуры, идентичные спорам. Это, повидимому, обеспечивает формирование более устойчивой и многочисленной популяции симбионтов в этой линии дрозофилы.

Научный руководитель – канд. биол. наук Е.В. Киселёва

СРАВНЕНИЕ КОДИРУЮЩИХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

ГЕНОВ СУМЧАТЫХ И ПЛАЦЕНТАРНЫХ МЛЕКОПИТАЮЩИХ

–  –  –

Сравнительная геномика – новое, бурно развивающееся направление современной биологии, которое исследует эволюцию генов и хромосом, а также выясняет филогенетическое родство организмов. Основная задача работы – построение филогенетического древа для различных представителей сумчатых (Metatheria) и плацентарных (Eutheria) млекопитающих на основе сравнительного анализа генов. Для ее осуществления были получены (посредством полимеразной цепной реакции с праймерами для консервативных районов генов других видов) и отсеквенированы фрагменты кодирующих последовательностей Х-хромосомных генов: Xpct, Brx, Hprt, Pgk1 и Ar, а также ряд аутосомных генов: Lrp4, Cdbp и Arp3 южно-американского серого короткохвостого опоссума Monodelphis domestica. Сравнительный анализ результатов (произведенный с помощью пакетов филогенетических программ) с опубликованными в электронных базах данных ортологичными последовательностями однопроходных, сумчатых и плацентарных млекопитающих показал существование генетических отличий между австралийскими и южно-американскими сумчатыми, сравнимых с различиями между мышью и человеком. В целом полученные результаты подтверждают предположение о существовании общего предка и близком родстве сумчатых и плацентарных, тогда как однопроходные представляют отдельную более раннюю ветвь в эволюции млекопитающих.

Научный руководитель – канд. биол. наук А.И. Шевченко

Т-ДНК-ИНДУЦИРОВАННЫЕ МУТАЦИИ

У ТРАНСГЕННЫХ РАСТЕНИЙ Nicotiana tabacum Е.А. Зоткевич Новосибирский государственный университет, Институт цитологии и генетики СО РАН, г. Новосибирск Наиболее широко используемым методом переноса чужеродных генов в растительный геном является использование почвенной бактерии Agrobacterium tumefaciens. A. tumefaciens способна переносить часть своей плазмиды (Т-ДНК) в растительное ядро. Таким образом, Т-ДНК может выступать в роли вектора чужеродных генов. Часть плазмиды, не относящаяся к Т-ДНК, или векторная ДНК, также способна к переносу.

Ранее в лаборатории гетерозиса растений ИЦиГ СО РАН методом агробактериальной трансформации с использованием различных типов генетических конструкций, содержащих гены неомицинфосфотрансферазы (nptII) и -глюкоронидазы, были получены трансгенные растения с изменённым строением цветка и нарушениями фертильности пыльцевых зёрен. При анализе мутантных растений было установлено, что мутантный признак наследуется сцепленно с канамицин-устойчивостью (ген nptII) у большинства трансформантов. Получены растения, проявляющие неполную косегрегацию изменения морфологического признака и канамицин-устойчивости. Одной из предполагаемых причин возникновения таких мутаций является встройка векторной рекомбинантной ДНК. В коллекции растений с мутантным фенотипом векторные последовательности были обнаружены в 53 % случаев. Часть этих растений содержала всю плазмиду. В геноме других мутантов кроме ТДНК были обнаружены усечённые копии векторных последовательностей. Векторные последовательности были найдены в геноме как у растений со сцепленным наследованием признаков, так и у растений с несцепленным характером наследования. Все растения с несцепленным характером наследования несли полноразмерные последовательности плазмидного вектора. В таких случаях векторная ДНК и Т-ДНК, повидимому, встраиваются в разные локусы хромосом, следствием чего является сцепленное наследование признаков канамицин-устойчивости и изменённой морфологии цветка. Среди канамицин-устойчивых потомков наблюдается расщепление на растения с изменённой морфологией цветка и растения, не несущие мутацию. Среди растений со сцепленным характером наследования преобладали растения с усечёнными копиями вектора.

Научный руководитель – канд. биол. наук Е.В. Дейнеко

РАЗРАБОТКА МЕТОДА КАРТИРОВАНИЯ ГЕНОВ

КОЛИЧЕСТВЕННЫХ ПРИЗНАКОВ in silico

–  –  –

В основе нового метода картирования генов, контролирующих комплексные признаки, лежит компьютерный анализ распределения фенотипических признаков и молекулярных маркеров в наборе инбредных линий мышей. Для того чтобы осуществить компьютерное картирование, необходим набор инбредных линий, каждая из которых характеризуется средним значением признака и генотипами различных локусов. Вопрос заключается в том, какую величину следует выбрать в качестве меры соответствия степени различия фенотипов и генотипов у разных линий и какой критерий использовать для установления статистической значимости этого соответствия. Grupe et al. (2001) предложили следующее решение этой проблемы. Если генотипы инбредных линий характеризуются полиморфными одиночными нуклеотидами (SNP), то чтобы охарактеризовать разницу генотипов различных пар линий, хромосомы мысленно режутся на перекрывающиеся участки длиной 30 сМ. На каждом таком участке для каждой пары линий подсчитывается число несовпадающих аллелей SNPмаркеров. О причастности локуса к контролю признака судят по корреляции между разницей средних значений признака у пар линий и степенью различия их генотипов в данном локусе. Мы провели проверку свойств данного метода, оценив устойчивость результатов анализа к набору анализируемых линий и к полноте заполнения генетической карты. Нами было исследовано 7 линий мышей: A/J, AKR/J, C3H/HEJ, BALB/COLJ, C57BL/J, DBA/2J, 129X1/SVJ по трём фенотипическим признакам: предпочтение алкоголя (А), вес глаза (В), количество ганглиев (С). Проведенное исследование показало, что результаты картирования существенно зависят от числа линий, вовлеченных в анализ. Последовательное исключение линий из набора приводит к изменению сайтов возможной локализации картируемых генов. Анализ устойчивости используемой характеристики дивергенции геномов различных линий к полноте заполнения генетической карты показал, что эта характеристика существенно меняется по мере заполнения генетической карты и изменения приводят к изменению сайтов возможной локализации картируемых генов. Эти результаты представляются важными для оценки надежности метода и указывают на необходимости дальнейшей разработки методов картирования in silico.

Научный руководитель – д-р биол. наук Т.И. Аксенович

МЕТОДИЧЕСКИЕ ПОДХОДЫ В СЕЛЕКЦИИ ЯРОВОГО ЯЧМЕНЯ

НА УСТОЙЧИВОСТЬ К ПОЛЕГАНИЮ

–  –  –

Полегание посевов считается одним из факторов, значительно ограничивающих получение стабильных урожаев ячменя хорошего качества. Разработаны специальные программы исследований, направленные на выявление причин, вызывающих полегание, поиск генетических источников и доноров устойчивости среди мирового генофонда, оценку исходного материала на провокационных фонах, создание селекционного материала разными методами (гибридизация, мутагенез), отбор положительных генотипов с учетом морфоанатомического строения побега ячменя. В условиях Сибири эти исследования проводятся давно, а на уровне изучения гибридного материала по морфоанатомическому строению стебля - с 1997 г.

С учетом почвенно-климатических факторов и оценкой в условиях ценотического стресса выделены генетические источники: Эльф, Рамос (Россия), Cork, Trebon (Эстония), Forum (Чехия), Brenda (Германия). Сорта Эльф и Brenda включены в систему диаллельных скрещиваний с сортами сибирской экологической группы (Неполегающий, Баган), которые характеризуются высокой адаптивностью к неустойчивому климату, иммунитету к болезням, продуктивностью, но отличаются по морфоанатомическому строению побега. Изучение реципрокных гибридов F1 между сортами Баган и Brenda выявило разный уровень наследования по таким анатомическим признакам, как диаметр междоузлия, толщина стенки, число сосудисто-волокнистых пучков, диаметр полости.

–  –  –

Выяснение оперонной структуры генома является важной задачей анализа геномных последовательностей прокариот. В настоящее время существует ряд методов распознавания оперонов. Наиболее известные методы позволяют точно устанавливать 60–80% генов. Большое значение имеет совместное применение различных методов с целью повышения результативности. В работе представлен оригинальный алгоритм анализа оперонной структуры геномов прокариот. Алгоритм основан на использовании индекса локальной комплементарности (LCI), который является мерой количества высокоэнергетичных вторичных структур. Ранее эта мера была удачно применена к изучению факторов, влияющих на эффективность экспрессии генов. Достоинством алгоритма является то, что в нем принятие решения о принадлежности гена к оперону основывается только на анализе сиквенсов полных геномов и не требует привлечения дополнительных данных. Алгоритм не требует значительных затрат машинного времени. Обучение алгоритма проведено на E. coli. В качестве обучающей выборки был взят набор экспериментально определенных оперонов, представленный на www.ecocyc.org. Было сформировано 17 групп генов, образованных в зависимости от расположения их в опероне. У каждой группы генов профиль LCI индивидуален, но наблюдаются и сходства между некоторыми участками профилей различных классов генов. Рисунки профилей близки у родственных видов бактерий, что, скорее всего, свидетельствует о том, что классы генов, имеющих сходные профили, присутствуют в одних и тех же соотношениях у этих видов. Результативность алгоритма составила 60 %, что сравнимо с ранее разработанными алгоритмами, учитывающими специфику организмов.

Научный руководитель – канд. биол. наук Ю.Г. Матушкин

–  –  –

З.Н. Кадырова, З.А. Кадырова, Т.А. Бозоров Национальный университет Узбекистана им. М. Улугбека, г. Ташкент Physalis alkengi является лекарственным растением, богатым алкалоидами, глюкозидами. Из мозаичных листьев выделен палочковидный вирус размером 18х300 нм. Точка тепловой инактивации вируса в соке составила 96–98 С, а предельное разведение 10-6-10-7, вирус из сока выпадает в осадок при рН=3,5. Этот вирус способен поражать различные сорта табака, лебеды, дурмана. Максимальное накопление вируса наблюдается в листьях верхнего яруса и на верхних частях стебля Physalis alkengi. Очищенный препарат из зараженных растений получили методом дифференциального центрифугирования из зараженных листьев табака. Клеточные компоненты удаляли использованием для их денатурации н-бутанол или хлороформ.

Концентрирование вируса осуществляли осаждением 4 %-м полиэтиленгликолем.

При выделении вируса из листьев физалиса его очистка стала намного труднее из-за присутствия красного пигмента. Спектрофотометрический анализ свидетельствовал о том, что чистый вирусный препарат имеет максимум при 260 нм. Отношение поглощения УФ-света при 260 и 280 нм равно 1,2. Препарат взаимодействует и образует линии преципитации с антисывороткой к томатному штамму ВТМ (титр сыворотки 1:8) при тестировании методом иммунодиффузии по Ухтерлони. Для максимального экстрагирования вируса из замороженных и сухих листьев добавили в экстрагирующий раствор некоторые вещества (5 -я глюкоза, 5 -й пептон, 10 мМ-я аскорбиновая кислота). Таким образом, из зараженных вирусом растений мы смогли выявить вирусы в увеличенном количестве.

Научный руководитель – д-р биол. наук, проф. А.Х. Вахабов

ПРИГОТОВЛЕНИЕ АНТИСЫВОРОТКИ К ВТМ

С ИСПОЛЬЗОВАНИЕМ ИММУНОМОДУЛИНА

В КАЧЕСТВЕ АДЪЮВАНТА

З.А. Кадырова, Т.А.Бозоров Национальный университет Узбекистана им. М. Улугбека, г. Ташкент Адъювант Фрейнда и другие давно используются в процессе приготовления антисыворотки, способствующей усилению антителообразования.

Для этого кролики породы Шиншилла за 7 дней до введения антигена иммунизировались лекарственным препаратом иммуномодулина три раза внутримышечно по 1 мг: 0,5 мг подмышечно и 0,5 мг подкожно. На второй неделе через каждые три дня 1 мг иммуномодулина вводили внутримышечно и подкожно под лопатки кролика с 1 мг вирусом табачной мозаики.

Затем через 7, 14 и 28 дней брали кровь из краевой ушной вены по 25–30 мл. Антисыворотку после отделения от форменных элементов крови центрифугировали при 5–6 тыс. об.\мин в течение 10 мин. Полученные антисыворотки разливались по 2 мл в пробирки и хранили при температуре –4 0С в присутствии хлороформа для защиты от бактериальных загрязнений. Определение титра антисыворотки проводили методом двойной диффузии по Ухтерлони и капельными методами. Раствор бактоагара “Дифко” (1 %) готовили на соответствующем буфере. В слое агара толщиной 3 мм специальными штампами выбивали лунки диаметром 2 мм, растояние между центрами лунок удаляли под вакуумом. На краевых участках агарового слоя выбивали лунки диаметром 6 мм для сохранения влажности агарового слоя и заполняли буферным раствором. После заполнения лунок антигенами и соответствующими антисыворотками стекло с агаровым слоем помещали во влажную камеру при комнатной температуре на 48 ч. Этот срок был достаточным для образования линии преципитации.

Результаты определения титра по Ухтерлони показали, что титр антисыворотки, полученной после иммунизации, составляет через 7 дней – 1:2, через 14 дней – 1:8 и через 28 дней – 1:8. Титр, определенный капельным методом, для семидневной сыворотки составил 1:1024 и через 14 дней 1:2048. Приготовленные антисыворотки используются в процессе разработки условий хранения томатного штамма вируса табачной мозаики.

Научный руководитель – д-р биол. наук А.Х. Вахабов

ВЛИЯНИЕ НЕКОНТРОЛИРУЕМЫХ ФАКТОРОВ

НА ТЕХНОЛОГИЧЕСКИЕ КАЧЕСТВА ЗЕРНА

–  –  –

Качество хлеба зависит от исходного сырья, из которого он выпекается.

Анализ данных о качестве зерна урожая, обследованного Государственной хлебной инспекцией, в течение нескольких лет показывает, что в Хакасии и на юге Красноярского края имеются в производстве высококачественные сорта, включенные в Государственный реестр: это семь сортов мягкой и один сорт твердой пшеницы. В настоящем исследовании к неконтролируемым факторам отнесены метеорологические условия. Для определения класса зерна обычно используют показатель объемной массы зерна, который значительно колебался по годам. Так, в пункте “Бейский” данный показатель варьировал от 750 до 809 г/л, “Усть-Абаканский” – от 750 до 773 г/л. В среднем по шести пунктам наибольшая объемная масса зерна была в 1998 г. (795 г/л), что на 33 г/л больше, чем в 2000 г.

Результаты оценки объемной массы зерна предоставлены лабораторией Госхлебинспекции по республике Хакасия.

Научный руководитель – канд. сел.-хоз. наук, доц. А.Н. Кадычегов

–  –  –

Дикорастущие виды томата являются источником многих хозяйственно-ценных признаков, таких как устойчивость к болезням и вредителям, устойчивость к неблагоприятным условиям выращивания. Передача этих признаков затруднена вследствие нескрещиваемости, или стерильности гибридов. Так, виды Solanum lycopersicoides и Lycopersicon esculentum хорошо скрещиваются, но гибриды бесплодны. Поэтому интрогрессия генетического материала S. lycopersicoides обычным путем затруднена. Одним из методов передачи материала является использование моносомно дополненных линий, несущих одну хромосому от другого вида. Эти формы, как правило, характеризуются низкой фертильностью пыльцы. Целью данного иследования являлось выяснение возможностей передачи генетического материала от S. lycopersicoides культурному томату. Изучение диакинеза – метафазы-I показало достаточно высокий уровень конъюгации (число хиазм составляло от 20 до 24), кроме того, обнаружена достаточно высокая частота встречаемости тривалентов, наличие которых свидетельствует о возможности обменов между хромосомами S. lycopersicoides и культурного томата. Асинхронность деления, а также высокая частота нарушений в виде отставаний хромосом, мостов, многополюсности при делении являются основными причинами высокой стерильности пыльцы. Так, показано, что в анафазах I-го и II-го деления отставания и мосты наблюдались с частотой в 41 и 18 % клеток соответственно. После первого мейотического деления в 15 % случаев одна хромосома находится вне пределов пластинок метафазы-II. Следует отметить и наличие отдельно лежащих хромосом в телофазе-II. На стадии тетрад в 10 % материнских клеток пыльцы наблюдаются пентады, однако другие нарушения (микроядра, триады) не выявлены. Таким образом, использование моносомно дополненной линии культурного томата с целью увеличения генетической изменчивости за счет наследственного материала S. lycopersicoides возможно, о чем свидетельствует образование тривалентов в I-м делении мейоза, но в то же время оно ограничено из-за высокой стерильности пыльцы таких форм.

Научный руководитель – канд. биол. наук, доц. А.А. Соловьев

СРАВНИТЕЛЬНЫЙ АНАЛИЗ ГОМЕОЛОГИЧНЫХ РАЙОНОВ

ХРОМОСОМ НЕСКОЛЬКИХ ВИДОВ МЛЕКОПИТАЮЩИХ

С ПОМОЩЬЮ BAC-КЛОНОВ

–  –  –

Сравнение структуры геномов многих видов указывает на сохранение синтении больших групп генов как у млекопитающих, так и у других позвоночных. Широко используемый для сравнительного геномного анализа метод – гетерологичный пэйнтинг – выявляет протяжённые участки межвидовой гомеологии хромосом. Для детального анализа структуры района необходимо сравнение точных локализаций маркеров. Сравнительное картирование позволяет нарисовать общую картину кариотипической эволюции млекопитающих, составить представление о темпах эволюции и хромосомных перестройках, сопровождающих её.

В работе определены локализации гомеологичных сегментов в одном из наиболее протяжённых консервативных районов у 5 видов млекопитающих с помощью BAC-клонов человека с известным генным содержанием и положением в геноме. У человека изучаемый район представлен хромосомой 17 (HSA17), у свиньи – хромосомой 12 (SSC12), у американской норки – длинным плечом хромосомы 5 (MVI5q), у иберийской бурозубки – частью плеча h (SGRh), у серебристо-чёрной лисы – участками хромосом 2 и 12 (VFU2, VFU12). С помощью гибридизации in situ установлены региональные локализации клонов: RP11-357O7 (содержит ген KIAA0732), RP11-601L9 (VR1, CARXL, P2RX5 и ITGAE), RP11-64J4 (OR3A1 и OR1D1), RP1-178F10* (LLGL1, SMCR7, SMCR8, FLII, SHMT1 и TOP3A) и BAC321G8 (PRKAR1A) в SSC12, RP11-357O7, RP11-601L9 и BAC321G8 в MVI5q, RP11-357O7, RP11-601L9, RP1-178F10* и BAC321G8* в SGRh, RP11-357O7, RP11-64J4*, в VFU2 и RP11-601L9* в VFU12 (* – предварительные локализации). У человека локализации клонов совпали с ранее установленными. Полученные данные свидетельствуют о том, что структура изученного консервативного района у свиньи, норки и бурозубки отличается от таковой у человека инверсией крупного района в HSA17p.

Кроме того, у иберийской бурозубки обнаружено изменение положения района, содержащего ген PRKAR1A.

Научный руководитель – канд. биол. наук Н.М. Астахова РАСПРЕДЕЛЕНИЕ АЛЛЕЙ ГЕНА Extension (MC1R)

В ПОПУЛЯЦИЯХ ЛОШАДЕЙ ОРЛОВСКОЙ РЫСИСТОЙ ПОРОДЫ

Н.В. Красикова Новосибирский государственный аграрный университет Аллели Е и е-гена Extension являются одними из факторов, детерминирующих тёмные и светлые окраски шерсти млекопитающих. Extension-ген был определён как последовательность ДНК, кодирующая рецептор меланоцитстимулирующего гормона – меланокортина 1 (MC1) и обозначен как MC1R. Целью работы стало изучение генетической структуры популяций лошадей по гену Extension. Объектом для ПЦР-анализа послужили образцы ДНК, выделенные из проб волос грив более 330 племенных лошадей орловской рысистой породы пяти заводских популяций. Обнаружена достоверная разнородность выборок по частотам аллелей (Р0,001) и генотипов (Р0,02) гена Extension, что не позволяет отнести их к одной генеральной совокупности. Во всех пяти выборках распределение Extensionгенотипов соответствовало теоретически ожидаемому по закону Харди– Вайнберга. Такая неоднородность популяций, входящих в одну породу, может быть вызвана двумя различными процессами: селективным (естественным и, главным образом, искусственным отбором) и стохастическим – дрейфом генов. Существующие породные стандарты предполагают одинаковую направленность искусственного отбора во внутрипородных популяциях. Кроме того, при относительной географической изоляции и уникальности происхождения отдельных заводских популяций между ними иногда происходит обмен производителями, который должен выравнивать межпопуляционные различия. При этом конематки постоянно используются в своих конных заводах, что обеспечивает некоторую стабильность их генофонда. Можно полагать, что выявленные межпопуляционные различия обусловлены дрейфом генов.

–  –  –

МОРФОФИЗИОЛОГИЧЕСКИЕ ОТВЕТЫ РАСТЕНИЙ

НА ДЕЙСТВИЕ АНТИМИТОТИЧЕСКОГО

АГЕНТА – ОРИЗАЛИНА, ЯВЛЯЮЩИЕСЯ ГЕНОТИПИЧЕСКИ ДЕТЕРМИНИРОВАННЫМИ

–  –  –

Цель работы состояла в выяснении зависимости физиологических и морфоцитологических процессов разных сортов пшеницы от структурной модификации цитоскелета при закаливании к холоду и действии стрессового фитогормона – абсцизовой кислоты (АБК). Объектом исследований служили корни проростков озимой пшеницы (Triticum aestivum L.) трех различающихся по морозоустойчивости сортов. В качестве агента, нарушающего полимеризацию тубулиновых микротрубочек, использовали высокоспецифический ингибитор полимеризации тубулиновых белков – оризалин, который добавляли в среду выращивания (10 мкМ). Закаливание растений проводили в термокамере при 3 °С в течение 7 суток. Показано, что дезорганизация тубулинового цитоскелета, обусловленная разборкой микротрубочек, приводила к повышению водоудерживающей способности и замедлению роста главных и боковых корней, а также увеличению их диаметра. Оризалин вызывал образование утолщений в виде луковиц на кончиках корней и увеличение размера клеток (особенно коровой паренхимы в зоне меристемы и растяжения), потерю клетками анизатропического роста и приобретение ими округлой или неправильной формы. Сильнее всего изменения были отмечены для корней среднеморозоустойчивого сорта, которые содержали больше тубулиновых и актиновых белков. Закаливание и АБК сортоспецифично снижали ростингибирующее и морфогенетическое действие оризалина на корни. Цитоскелет принимает участие в низкотемпературной адаптации, регулируя морфофизиологические процессы, и это участие определяется генотипом растений.

Научный руководитель – проф. А.И. Хохлова

ОСОБЕННОСТИ РАЗМНОЖЕНИЯ И РЕВЕРСИИ К S-ТИПУ

R-ВАРИАНТОВ Bacilus thuringiensis

–  –  –

Для Bacillus thuringiensis известна диссоциативная изменчивость, выражающаяся в том, что в клоновых культурах среди форм, образующих споры и кристаллы д-эндотоксина (S-варианты), возникают формы с нарушенным споро- и кристаллообразованием (R-варианты). Считается, что процесс диссоциации имеет адаптивное значение. Нами установлено, что повышение температуры культивирования до 40оС увеличивает частоту встречаемости R-вариантов в стационарной фазе роста периодических культур, но возникающие при повышенной температуре R-варианты не отличаются от S-форм по устойчивости к данному фактору. Для того чтобы выяснить, не является ли увеличение частоты встречаемости R-вариантов результатом большей скорости их размножения, провели сравнительный анализ скорости размножения штамма дикого типа и R-вариантов, выделенных при повышенной температуре и возникших спонтанно при оптимальных условиях. Установлено, что все морфологические варианты не отличались от исходного S-варианта по скорости размножения в логарифмической фазе роста, но отличались большей пролонгированностью стационарной фазы. Если штамм дикого типа переходил в стадию отмирания на 48 часу, то у R-вариантов снижение концентрации клеток не происходило даже к 168 часу культивирования. Отсюда следует, что наблюдаемое увеличение частоты R-вариантов после 24 часов в культуре дикого типа может быть связано не с большей скоростью размножения возникающих R-вариантов, а с их большей жизнеспособностью в стационарной фазе роста. Показано, что только у спонтанно полученного R-варианта на 72 часу культивирования резко возрастала гетерогенность популяции, среди исходных R-форм появлялись приближенные к дикому типу по морфологии колоний формы. У вариантов, полученных в условиях повышенной температуры, такой гетерогенности не наблюдали. Следовательно, R-варианты различаются по способности к обратному переходу.

Научный руководитель – канд. биол. наук, доц. В.И. Чемерилова

ПОЛУЧЕНИЕ МОНОСОМНЫХ ГИБРИДОВ СОМАТИЧЕСКИХ

КЛЕТОК ОПОССУМ-КИТАЙСКИЙ ХОМЯЧОК

–  –  –

Cумчатые – это наиболее древние млекопитающие. Исследование Х-хромосомы опоссума (Monodelphis domestica) может оказаться полезным для понимания ранних этапов эволюции Х-хромосом и системы дозовой компенсации у млекопитающих. Гибридные клоны, содержащие одну Х-хромосому опоссума, планируется использовать для проведения картирования Х-хромосомы молекулярно-генетическими методами. Ранее были получены гибриды соматических клеток путем слияния фибробластов китайского хомячка линии Ag17-1 (HPRTЇ) с клетками костного мозга, селезенки и фибробластами серого короткохвостого опоссума.

Из полученных культур для дальнейшей работы был взят клон, содержащий клетки с хромосомами Х, 3, 4 и 5 опоссума. Проведено субклонирование данного клона методом переноса микрокапилляром индивидуальных клеток в лунки 96-ячеечного плато. Субклоны культивировали на среде, содержащей HAT. Цитогенетический анализ клонов проводили методом гибридизации in situ фрагментированной геномной ДНК опоссума, меченной биотином, а также Х-специфичной микродиссекционной библиотеки, меченной родамином, на метафазные хромосомы гибридов. В исходном клоне доля моносомных клеток, содержащих одну Х-хромосому, составила около 40 %.

Гибридизационных сигналов геномной ДНК опоссума на хромосомах китайского хомячка выявлено не было, что свидетельствует о сильной дивергенции геномов сумчатых и грызунов. Однако выявлены сигналы гибридизации Х-специфичной пробы на аутосомах опоссума, которые, вероятно, проявляются за счет повторяющихся последовательностей генома.

Научный руководитель – д-р биол. наук, проф. С.М. Закиян ЧАСТОТЫ АЛЛЕЛЕЙ G73965C ГЕНА TRPM8, КОДИРУЮЩЕГО

ПОТЕНЦИАЛЬНЫЙ ХОЛОДОВОЙ РЕЦЕПТОР, В НЕКОТОРЫХ

ЭТНИЧЕСКИХ ГРУППАХ СЕВЕРНОЙ АЗИИ

–  –  –

Известно, что терморегуляция – важнейшее эволюционное приобретение теплокровных, обусловливающее адаптационный потенциал к проживанию в различных температурных режимах. По всей видимости, в молекулярных механизмах адаптации к температуре существенная роль может принадлежать рецепторному звену. Изучение структурной вариабельности генов, кодирующих температурные рецепторы, в популяциях, проживающих в различных климато-географических зонах, возможно, позволит прояснить молекулярные механизмы адаптации человека к экстремальным температурным условиям. В настоящее время у человека клонирован ген TRPM8, кодирующий полипептид, высокогомологичный холодовому рецептору CMR1 крысы. Белок CMR1 имеет отношение к катионному каналу, активация которого происходит в ответ на действие холода или ментола. Это позволяет предполагать возможное участие гена TRPM8 в формировании врожденной адаптивной реакции человека на холод. Недавно был описан однонуклеотидный полиморфный сайт в позиции 73965 6 экзона гена TRPM8 (GenBank accession No. AC005538). Трансверсия GC не приводит к замене аминокислоты в белке (синонимичная замена).

Целью работы было изучение частот аллелей G73965C гена TRPM8 в этнических группах, проживающих в условиях умеренного (русские), континентального (шорцы, тувинцы) и арктического климата (чукчи, канадские эскимосы). У чукчей также предполагалось изучить возможную ассоциацию полиморфизма с антропометрическими и биохимическими показателями. В результате анализа образцов ДНК с помощью аллельспецифической ПЦР было обнаружено, что в популяциях шорцев (n = 106), канадских эскимосов (n = 85) и чукчей (n = 104) более редкий аллель С73965 гена TRPM8 встречается с частотами 33,5, 34,1 и 28,8 % соответственно. У тувинцев (n = 142), проживающих в сходных с шорцами климато-географических условиях, частота этого аллеля составила 21,1 %.

Наименьшую частоту (11,4 %) данного аллеля наблюдали у русских (n = 149). Популяция русских достоверно отличается по частотам аллелей G73965C от остальных изученных популяций, а популяция тувинцев – от шорцев и канадских эскимосов. Распределение частот генотипов в популяциях русских и шорцев соответствовало равновесию Харди–Вайнберга, а в популяциях тувинцев и канадских эскимосов наблюдали статистически значимое отклонение, причины которого непонятны и требуют дальнейшего изучения. В популяции чукчей была выявлена достоверная связь между генотипами и такими антропометрическими показателями, как объем талии (F = 4,175, р = 0,018) и индекс талии/бедер (F = 4,567, р = 0,013). При этом самые высокие значения этих показателей наблюдали у гетерозигот (как мужчин, так и женщин), что, возможно, обусловлено специфической адаптивной реакцией чукчей на экстремальные температурные условия среды. Достоверных ассоциаций с другими количественными признаками не выявлено. Таким образом, нами выявлены достоверные межпопуляционные различия по частотам аллелей G73965C гена TRPM8 в изученных этнических группах. У чукчей обоего пола обнаружена связь гетерозиготных генотипов с увеличенным объемом талии и индексом талии/бедер.

–  –  –

ГЕНЕТИЧЕСКИЙ КОНТРОЛЬ РАЗВИТИЯ ЛИСТА ТОМАТА

Л.А. Новикова, Е.А. Комарова Московская сельскохозяйственная академия им. К.А. Тимирязева У томата описано большое количество генов, отвечающих за морфогенез листа. Культурный томат (Lycopersicon esculentum) имеет однорасчлененный лист, мутации могут как увеличивать, так и уменьшать степень расчлененности листа, что делает томат удобным объектом для изучения морфогенеза расчлененного листа. На кафедре генетики МСХА осуществляется работа по изучению взаимодействия генов, ответственных за морфогенез листа. Для этого проводится две серии скрещиваний между десятью формами томата, мутантными по типу листа. В работе используются мутанты: Мо 755 (картофельный тип листа, ген не локализован; Mo 500+S (с/с – картофельный лист), LА 0512 (tf/tf – тройчатый лист), LА 0715 (Ме/+ – «мышиные ушки»), Мо 319 (La/+ – ланцетный лист), LА 0784 (е/е – искривленная жилка листа), LА 1101 (sf/sf – цельнокрайние доли), Mo 556 (tp/tp – тройчатый лист), Мо 304 (bip/bip – дваждырассеченный лист) и сорт Moneymaker (Mm) с нормальным типом листа. В качестве материнских форм взяты Мо 755 и Мо 500+S. На данной стадии эксперимента в первой серии получены растения F 1 во всех комбинациях скрещиваний, во второй – в шести комбинациях (с растениями Мо 556, Mm,

LA 0512, LA 0715, LA 0784, Mo 304, Mo 319). У гибридов с LA 0715 наблюдается расщепление 1:1 (дикий тип: «мышиные ушки»). У растений F 1:

Мо 755 х Мо 500+S (c/c) проявился признак картофельного листа, что может объясняться наличием аллельного гена с в материнской форме. При скрещивании обеих форм с мутантным образцом Мо 319 (La/la) у гибридов F1 обнаружился только нормальный тип листа. У гибридов F1 Мо 500+S х Мо 556 проявился тройчатый лист, отличающийся от исходной формы, в то время как гибриды Мо 755 х Мо 556 имели лист нормального типа. В остальных комбинациях скрещиваний получены листья дикого типа (с некоторыми отклонениями от нормы), так как гибриды F 1 являются гетерозиготными и рецессивные мутантные аллели не проявляются. У гибридов F1 с участием формы Мо 304 (bip/bip) обнаружено увеличение рассеченности листа, что, возможно, обусловлено взаимодействием генов с и bip.

Научный руководитель – канд. биол. наук, доц. А.А. Соловьев

ПОЛУЧЕНИЕ И АНАЛИЗ ПЕРЕСТРОЕК ВО ВТОРОМ ИНТРОНЕ

ГЕНА Trithorax-like Drosophila melanogaster

–  –  –

Регуляция экспрессии генов эукариот остается одним из самых актуальных вопросов современной генетики. В последние годы появляется все больше данных, свидетельствующих о функциональной значимости интронов в регуляции экспрессии генов. В настоящей работе в качестве модели использовался ген Trithrax-like (Trl) Drosophila melanogaster, кодирующий транскрипционный фактор GAGA. Целью данной работы являлось получение перестроек, затрагивающих второй интрон гена Trl, и их дальнейший молекулярно-генетический анализ для выявления функционально-значимых последовательностей, участвующих в регуляции экспрессии данного гена. При использовании Р-индуцированной рекомбинации у самцов было получено 12 мутаций по гену Trl. Картирование полученных перестроек проводилось с использованием методов ПЦР-анализа, секвенирования полученных ПЦР-продуктов и методом цитологического анализа. Показано, что 8 делеций затрагивают как интрон, так и кодирующую область гена, 4 делеции затрагивают только интрон (размеры этих делеций варьируют от 45 до 1375 п.н). Получены предварительные данные, свидетельствующие о наличии функционально-значимых последовательностей во втором интроне гена Trl. Жизнеспособность гомозиготной линии, несущей делецию 1200 п.н. в середине интрона, снижена на 50 % при 25 0С и на 80 % - при 29 0С.

Научный руководитель – канд. биол. наук Э.М. Баричева ИЗУЧЕНИЕ ДИПЛОИДНОГО ПАРТЕНОГЕНЕЗА У Fragaria vesca L

–  –  –

Для дикорастущей лесной земляники Fragaria vesca L. (2n=2x=14) характерно воспроизводство семенным и вегетативным (с помощью стелющихся наземных столонов) способами. В благоприятных условиях благодаря самоопылению завязывается около 75 % семян. Наличие у F. vesca нередуцированных яйцеклеток ранее было подтверждено получением так называемых полуторных гибридов в межвидовых скрещиваниях. С помощью технологии индукции партеногенеза у земляники получены первые сеянцы F. vesca партеногенетического происхождения с диплоидным числом хромосом. В благоприятных условиях опыления семена у F. vesca формируются путем двойного оплодотворения, и лишь в стрессовых условиях оплодотворения путь развития зародыша переключается на партеногенетический. Нами проведен опыт по изучению экспрессии диплоидного партеногенеза у лесной земляники различного географического происхождения. Для этого была использована методика индукции партеногенеза с помощью чужеродного опыления кастрированных цветков лесной земляники пыльцой лапчатки гусиной Potentilla anserina L. (2n=4x=28). В опыт были вовлечены 7 образцов F. vesca. Общее количество высеянных семян по всем образцам составило 2725 шт. Всхожесть семян была крайне низкой, от 0,2 до 5,6 %. Всего получено 31 растение с 2n=14, как и у материнской формы. Цитоэмбриологическое исследование показало отсутствие опережающего развития зародыша. Партеногенетическое развитие зародыша наступало после того, как сформируются 4 или 8 ядер эндосперма.

Не обнаружено признаков диплоидизации редуцированной яйцеклетки, при которой восстанавливается диплоидный набор хромосом. Диплоидность партеногенетически развивающейся яйцеклетки обусловлена нередуцированным состоянием мегаспоры. Диплоидный партеногенез у F. vesca псевдогамного типа; его экспрессия низкая (1,7 %) и варьирует в изученных образцах.

Научный руководитель – канд. биол. наук С.О. Батурин

ЦИТОГЕНЕТИЧЕСКОЕ ИССЛЕДОВАНИЕ МЕЖВИДОВЫХ

ГИБРИДНЫХ КЛОНОВ, ПОЛУЧЕННЫХ ОТ СЛИЯНИЯ

ЭМБРИОНАЛЬНЫХ СТВОЛОВЫХ КЛЕТОК Mus musculus И СПЛЕНОЦИТОВ Mus caroli

–  –  –

В 1999 г. в лаборатории генетических основ онтогенеза были получены 17 гибридных клонов от слияния плюрипотентных эмбриональных стволовых (ES) клеток Mus musculus и спленоцитов (клеток селезенки) Mus caroli. В таких гибридных клетках складывается уникальная ситуация, когда два различных генома, находящиеся на разных этапах дифференцировки, могут обмениваться трансрегуляторными факторами, что позволяет изучать взаимоотношения геномов с разной историей развития.

Работа проводилась на шести первичных клонах: НМС4, НМС15, НМС27, НМС44, НМС54 и НМС58. Цитогенетический анализ данных клонов показал, что они содержали различную долю тетраплоидных и околотетраплоидных клеток (от 80 % – клоны НМС4, НМС44 и НМС54; до 55 % – клоны НМС15 и НМС27). В клоне НМС15 также значительную часть составляли клетки с околодиплоидным набором хромосом (37 %), а в клонах НМС4 и НМС27 – с промежуточным количеством хромосом (45-70 хромосом).

Большинство клеток клонов имело 2 Х-хромосомы, тогда как Y-хромосома часто сегрегировала. Так, в клонах НМС4 и НМС15 Y-хромосому содержала лишь малая часть клеток – 14 %, в остальных – около половины.

Исследование при помощи in situ-гибридизации с ФИТЦ-меченным зондом, специфичным для хромосом Mus musculus, показало, что соотношение родительских геномов в исследуемых клонах варьирует: часть клонов содержала равное количество хромосом родительских клеток (НМС4, НМС44 и НМС27). В остальных клонах (НМС15, НМС54 и НМС58) доля хромосом Mus caroli была незначительной, в то время как число хромосом Mus musculus приближалась к 4N. При культивировании в неселективных условиях клоны возвращались к нормальному или близкому к нормальному диплоидному состоянию (40-43 хромосомы) с небольшой примесью тетраплоидов. Показано, что все оставшиеся хромосомы принадлежали плюрипотентному партнеру. Таким образом, в данных клонах происходит сегрегация хромосом соматического партнера.

Научный руководитель – канд. биол. наук И.Е. Пристяжнюк

СИСТЕМА ПОИСКА ФУНКЦИОНАЛЬНЫХ САЙТОВ

В ПРОСТРАНСТВЕННЫХ СТРУКТУРАХ БЕЛКОВ - PDBSite

–  –  –

Распознавание функциональных сайтов в белках является одним из важных подходов к определению их функции. База данных PDBSite по биологически активным сайтам выделена из базы данных белковых структур PDB (Protein Data Bank). База данных PDBSite содержит: описание функции сайтов, список аминокислотных остатков и их позиции; структурные особенности, рассчитанные по пространственным структурам белков; физико-химические характеристики сайтов и их пространственного окружения. В базе данных PDBSite содержатся характеристики пространственных структур многих активных сайтов белков, сайтов связывания с различными лигандами, а также сайтов биохимической модификации. Нами разработан пакет программ для распознавания функциональных сайтов в пространственных структурах белков, который интегрирован с базой данных PDBSite. Данные программы осуществляют гибкий поиск сходства между третичной структурой анализируемого белка и структурой сайтов из базы данных PDBSite. Это позволяет обнаружить потенциальные функциональные сайты в пространственной структуре анализируемого белка и получить их структурное выравнивание с функциональными сайтами из PDBSite. Доступ к базе осуществляется с использованием системы SRS (Sequence Retrieval System). Создана дочерняя база PDBSiteClass к базе PDBSite, представляющая собой классификационное дерево сайтов по их функциональному типу. PDBSiteClass имеет HTML-интерфейс.

http://srs6.bionet.nsc.ru/srs6bin/cgi-bin/wgetz?-page+LibInfo+-newId+lib+PDBSite http ://wwwmgs.bionet.nsc.ru/mgs/systems/fastprot/.

http://wwwmgs.bionet.nsc.ru/mgs/systems/fastprot/pdbsitescan.html Научный руководитель – канд. биол. наук В.А. Иванисенко

ВЛИЯНИЕ КАРТОЛИНА НА АКТИВНОСТЬ ЛЕКТИНОВ

ПРИ МОДИФИКАЦИИ ЦИТОСКЕЛЕТА

–  –  –

Процессы адаптации растений к экстремальным факторам внешней среды, в частности к низким температурам, в большой степени контролируются веществами гормонального типа. Не вызывает сомнений ключевая роль АБК в индукции синтеза более десятка стрессовых белков, к которым относится лектин пшеницы. Вместе с тем актуально использование в растениеводстве фитогормонов, в спектре физиологического действия которых проявляется четко выраженный антистрессовый эффект. В связи с этим нами был применен синтетический аналог цитокининов картолин.

Цель работы состояла в выявлении зависимости активности лектинов от структурной целостности цитоскелета и картолина в условиях адаптации растения к низким температурам. Объектом исследования служили корни семидневных проростков озимой пшеницы трех сортов, различающихся по морозоустойчивости: Безостая 1 – маломорозоустойчивый сорт, Мироновская 808 – среднеморозоустойчивый сорт, Альбидум 114 – высокоморозоустойчивый сорт. Закаливание проводили в низкотемпературной камере при 2-3 oC в течение 7 суток. Ингибитор полимеризации микротрубочек оризалин (10 мкМ) вводили в ткани путем инкубации отсеченных корней в растворе. В серии экспериментов с картолином растения выращивали на дистиллированной воде с концентрацией картолина в 10-3 %. Растворимые лектины экстрагировали 0,05н HCl, лектины клеточной стенки 0,05 %-м раствором тритона X-100. Активность лектинов определяли методом агглютинации трипсинизированных эритроцитов человека. Содержание белка измеряли по методу Бредфорда. Выращивание растений на среде с картолином приводило к увеличению активности растворимых лектинов, особенно в закаленных растениях. Вероятно, под влиянием низких температур происходит индукция синтеза стрессовых белков, к которым относятся и растворимые лектины. Реакция на картолин лектинов клеточной стенки в закаленных растениях отсутствовала. Это позволило предположить, что изменения их активности относятся к первичным ответным реакциям на действие низкой температуры, которые являются при этом недолговременными, но необходимыми для формирования устойчивости. Обработка тканей структурным модификатором микротрубочек оризалином снижала активность растворимых лектинов и увеличивала активность лектинов клеточной стенки. Повидимому, активность лектинов зависит от структурной целостности цитоскелета. Картолин, добавленный в среду выращивания незакаленных растений, снимал эффект оризалина на активность лектинов (Альбидум 114) или уменьшал его действие (Мироновская 808 и Безостая 1). В закаленных растениях действие оризалина на фоне картолина изменялось на противоположное. Таким образом, картолин положительно влияет на тубулиновые филаменты, препятствуя их дестабилизации.

Научный руководитель – канд. биол. наук, доц. О.А. Тимофеева

–  –  –

У самок млекопитающих в качестве механизма дозовой компенсации был описан процесс инактивации одной из двух Х-хромосом, обеспечивающий эквивалентные уровни экспрессии генов, находящихся в половых хромосомах. Контроль данного процесса осуществляется сложноорганизованным генетическим локусом – центром инактивации (Xic). В пределах данного локуса обнаружен ряд генетических элементов. Один из них – ген Xist – ключевой фактор для инициации инактивации, кодирующий гигантскую нетранслируемую ядерную РНК (длиной около 17 т.п.н.), которая распространяется вдоль будущей неактивной Х-хромосомы. Другой важнейший элемент – ген Tsix, который экспрессируется в антисмысловой ориентации к гену Xist и, вероятно, препятствует синтезу стабильного транскрипта Xist, защищая Х-хромосому от инактивации. В области промотора Tsix у мыши находится регуляторный элемент DXPas34 – CpG – богатый район, соcтоящий из 34-мерных минисателлитных повторов, предположительно принимающий участие в регуляции экспресии генов Xist и Tsix, в выборе Х-хромосомы и инициации инактивации.

Данная работа включала следующие стадии: 1) субклонирование последовательности 5’-области гена Tsix полевок Microtus kirgisorum и Microtus rossiaemeridionalis из ДНК рекомбинантного фага, полученного в результате скрининга геномной библиотеки; 2) определение нуклеотидных последовательностей ДНК субклонированных фрагментов генома полевок; 3) контекстный анализ полученных последовательностей, сравнение гомологичных последовательностей M. kirgisorum и M. rossiaemeridionalis между собой и с гомологичными последовательностями центра инактивации мыши; 4) анализ субклонов, полученных в результате 5’- и 3’-RACEэкспериментов и установление 5’-и 3’-границ гена Tsix у полевок, его экзон-интронной структуры и вариантов сплайсинга на основании результатов анализа. Установлено, что экзон-интронная структура гена Tsix у полевок несколько отличается от таковой у мыши. Участок гена Tsix в его 5’области значительно отличается между мышью и полевкой, гомология данного локуса между человеком и грызунами обрывается сразу за геном Xist. В районе промотора гена Tsix у исследованных видов полевок также был выявлен блок тандемных повторов, аналогичный регуляторному элементу DXPas34 Mus musculus, в нем отмечено наличие CpG-островков, однако в отличие от мышиного для найденного блока повторов была характерна гетерогенность мономеров. Следовательно, структура гена Tsix достаточно лабильна у мыши, полевки и человека и может претерпевать значительные изменения, хотя для некоторых районов показана значительная консервативность.

–  –  –

ВЛИЯНИЕ ГЕПАТОТОКСИНОВ ОАТ И CCl4

НА ПРОЛИФЕРАТИВНУЮ АКТИВНОСТЬ ГЕПАТОЦИТОВ

ПЕЧЕНИ МЫШИ ПРИ КРАТКОВРЕМЕННОЙ

И ДЛИТЕЛЬНОЙ ЭКСПОЗИЦИИ С НИМИ

–  –  –

Модель гепатоканцерогенеза крыс и мышей получила широкое распространение для изучения ранних событий в канцерогенном процессе. Это связано с тем, что большинство химических соединений для проявления канцерогенного потенциала требует метаболической активации, которая эффективно происходит в печени благодаря высокому уровню ферментов метаболизма ксенобиотиков. Ранее нами было показано, что ортоаминоазотолуол (ОАТ) вызывает остановку пролиферации гепатоцитов печени, стимулированной ЧГЭ, у линий мышей, чувствительных к данному токсину, при введении его до операции. Поскольку у чувствительных к ОАТ линий мышей (А/Не) наблюдалось подавление пролиферативной активности, было сделано предположение, что канцероген приводит к остановке пролиферации, вызванной ЧГЭ, в G1-периоде. Исходя из этого канцероген вводили мышам в различное время после ЧГЭ. Оказалось, что кратковременная экспозиция мышей линий А/Не и Balb/c с ОАТ после ЧГЭ не приводит к подавлению пролиферативной активности гепатоцитов in vivo.

Введение мышам ОАТ через 30 мин и 2 ч после ЧГЭ приводило к наиболее выраженной стимуляции пролиферации, тогда как в более поздние сроки после ЧГЭ происходило снижение пролиферативной активности. На следующем этапе по той же схеме были проведены эксперименты с использованием другого гепатотоксина - CCl4, обладающего как токсическим, так и гепатоканцерогенным воздействием на все линии мышей. Было получено, что CCl4 не подавляет пролиферацию гепатоцитов, стимулированную ЧГЭ. При длительной экспозиции (в течение 3-х месяцев) ОАТ приводил к снижению пролиферативной активности, вызванной ЧГЭ, у чувствительных и в меньшей степени – у устойчивых линий мышей. CCl4 подавлял пролиферацию в еще большей степени. Исследование динамики роста массы печени в обоих случаях показало, что печень восстанавливается через две недели, несмотря на воздействие гепатотоксина.

Таким образом, на ранних этапах гепатотоксины не подавляют пролиферативную активность, вызваннную ЧГЭ, тогда как длительная экспозиция негативно влияет на пролиферацию гепатоцитов.

–  –  –

О.П. Савчук, H.А. Ситникова, Е.В. Григорьева Новосибирский государственный университет, Институт цитологии и генетики СО РАН, г. Новосибирск Эмбриональные стволовые (ЭС) клетки используются в исследованиях молекулярного механизма неслучайной X-инактивации. Инактивация одной из родительских Х-хромосом, происходящая в стволовых клетках при их дифференцировке in vitro в эмбриоидные тельца, моделирует ситуацию, происходящую в норме. Это открывает широкие перспективы в получении различных мутаций центра инактивации (Xic) и анализе их влияния на вероятность инактивации родительских Х-хромосом. Источниками ЭС клеток являются как внутренняя клеточная масса бластоцист, так и примордиальные герминальные клетки эмбрионов. ЭС клетки культивировали на фидере, в качестве которого использовали обработанные митамицином С первичные фибробласты Microtus rossiaemeridionalis, полученные из 12-13-дневных эмбрионов. Клетки фидера продуцируют фактор LIF (leukemia inhibitory factor), препятствующий дифференцировке. На 3,5 дня после оплодотворения из яйцевода матки вымывали морулы и бластоцисты (ранние, средние и поздние), сажали в лунки с фидером и через 3-5 дней, в зависимости от степени роста, отделяли микрохирургическим методом клетки внутренней клеточной массы (ICM) от клеток трофобласта.

Затем ICM либо механически делили микрокапиллярами на отдельные куски и клетки, либо использовали трипсин для дезагрегации клеток. У 6,5-8,5-дневных эмбрионов удаляли переднюю его половину на уровне закладки сердца. Клетки задней половины дезагрегировали трипсином и сажали на желатинизированные лунки с фидером. У 12,5-дневных эмбрионов выделяли половые валики и механически разделяли микрокапилляром в присутствии трипсина. Среди выросших островков отбирали ЭС-подобные и пассировали.

Научный руководитель – канд. биол. наук Н.А. Мазурок

СТРУКТУРНАЯ ДИНАМИКА И ВЗАИМОСВЯЗЬ ЯДЕРНОЙ

ОБОЛОЧКИ И ЭНДОПЛАЗМАТИЧЕСКОГО РЕТИКУЛУМА

В РАСТУЩИХ ООЦИТАХ АМФИБИЙ

–  –  –

В процессе жизнедеятельности клеток существует тесная связь между функционированием ядерной оболочки, эндоплазматического ретикулума (ЭПР) и других ее компартментов. Для выяснения структурных и функциональных особенностей клеточных органелл проводилось комплексное исследование, включающее сравнительный анализ структурной динамики взаимодействующих друг с другом мембранных систем клетки. Задачей исследования являлся ультраструктурный анализ динамики ядерной оболочки и ЭПР в растущих ооцитах амфибий, а также выяснение возможной роли окончатых мембран – специфического компартмента ЭПР, содержащего пороподобные комплексы, сходные с ядерными поровыми комплексами (ЯПК), и других мембранных структур в формировании ядерной оболочки. Электронно-микроскопический анализ показал, что ЯПК в растущих ооцитах амфибий формируются через промежуточные структуры.

Выяснено, что на 4-5 стадии развития ооцитов новые ЯПК формируются локально в области слияния крупных пузырьков ЭПР с наружной ядерной мембраной. Наиболее интенсивное формирование ЯПК наблюдается на 2-3 стадии оогенеза. Предложена схема сборки ЯПК в растущих ооцитах амфибий. Впервые продемонстрировано прямое слияние окончатых мембран с ядерной оболочкой. На 3-й стадии развития регистрируется накопление мембран ЭПР в цитоплазме ооцита в виде стопок или цепочек пузырьков.

Впервые в цитоплазме ранних ооцитов обнаружены миелиноподобные структуры (МПС), состоящие из 30-40 плотно упакованных мембранных слоев. Исследование распределения этих плотных телец показало, что они встречаются в цитоплазме ооцита, а также в прилежащих фолликулярных клетках и в межклеточном пространстве. На 3-й стадии оогенеза, характеризующейся высокой функциональной активностью клетки, МПС декомпактизуются и формируют цистерны гладкого ЭПР. При этом наблюдаются переходные стадии декомпактизации. Высказано предположение о возможной функции МПС в качестве мембранного депо для сборки ЭПР в ооцитах амфибий.

Работа выполнена при поддержке гранта РФФИ № 01-04-49855.

Научный руководитель – канд. биол. наук Е.В. Киселева ЧАСТОТЫ АЛЛЕЛЕЙ C-1314-T ПОЛИМОРФИЗМА ГЕНА

ОЛИГОАДЕНИЛАТСИНТЕТАЗЫ (OAS3) У РУССКИХ И ЧУКЧЕЙ

Е.П. Сивкова, А.В. Бархаш Сибирский государственный медицинский университет, г. Томск, Институт цитологии и генетики СО РАН, г. Новосибирск Инфекционные вирусные заболевания представляют собой одну из наиболее актуальных проблем медицины из-за высокой распространенности, способности вызывать эпидемии и отсутствия специфических этиотропных методов лечения. Показано, что устойчивость/восприимчивость организма к некоторым вирусам может быть детерминирована генетически. Поиск генов, обусловливающих наследственную устойчивость/восприимчивость к определенным вирусам, необходим для понимания молекулярных механизмов противовирусной защиты организма и определения возможных путей разработки эффективных методов профилактики и терапии вирусных заболеваний.

Олигоаденилатсинтетазы представляют собой семейство ферментов, индуцируемых интерфероном и играющих важную роль в противовирусном ответе организма. Активность этих ферментов увеличивается в присутствии двухцепочечной РНК, образующейся в клетке при вирусной инфекции. Они катализируют полимеризацию ATФ в 2/-5/-связанные олигоаденилаты, которые взаимодействуют с рибонуклеазой L и активируют ее, что приводит к деградации вирусной и клеточной РНК и, вследствие этого, – снижению синтеза белка в клетке. Это позволяет рассматривать гены семейства олигоаденилатсинтетаз (OAS) в качестве вероятных кандидатов, определяющих наследственную устойчивость млекопитающих, и в частности человека, к ряду вирусных инфекций. В пользу этого предположения свидетельствуют исследования, проведенные на мышах, в которых было показано, что различия в восприимчивости или устойчивости к инфекциям, вызываемым флавивирусами, между некоторыми родственными линиями определяются мутациями гена Oas1b, входящего в семейство генов, кодирующих олигоаденилатсинтетазы.

В данной работе исследовали распространение синонимичной однонуклеотидной замены C-1314-T в 6-м экзоне гена OAS3, кодирующего высокомолекулярную изоформу белка, в популяциях чукчей (n=114) и русских (n=134). Материалом для исследования служила геномная ДНК, выделенная из крови с помощью фенольной экстракции. Генотипирование проводили с помощью гидролиза ПЦР-продукта соответствующего участка гена OAS3 рестриктазой TaqI с последующим разделением фрагментов в 4 %-й ПААГ. Исследованные популяции чукчей и русских достоверно различались по частоте менее распространенного аллеля Т (7,5 и 16,8 %, соответственно; 2=9,8, P0,01). В обеих изученных популяциях не выявлено отклонения распределения частот генотипов от равновесия Харди– Вайнберга. Обнаруженные различия в частотах распределения редкого аллеля гена OAS3 в этнических группах разных рас можно объяснить действием отбора и, следовательно, либо функциональным вкладом данного полиморфизма в представленность белка, либо его сцепленностью с другим полиморфизмом внутри гена или вне его.

Таким образом, выявлены значительные различия между изученными популяциями по однонуклеотидной замене C-1314-T гена OAS3. Это позволяет предполагать, что данный полиморфизм является информативным генетическим маркером для дальнейших исследований ассоциации полиморфных вариантов гена OAS3 с предрасположенностью к различным вирусным инфекциям.

Научный руководитель – канд. биол. наук Н.С. Юдин

МУТАТОРНАЯ (MR) АКТИВНОСТЬ И ЛЕТАЛЬНЫЕ МУТАЦИИ

В ХРОМОСОМЕ 2 В СРЕДНЕАЗИАТСКИХ ПОПУЛЯЦИЯХ

Drosophila melanogaster Я.Я. Синянский, В.С. Волкова, А.В. Иванников Новосибирский государственный университет, Институт цитологии и генетики СО РАН, г. Новосибирск В 1988 г. в лаборатории генетики популяций ИЦиГ СО РАН были начаты исследования генов-мутаторов класса “MR-фактор” и их влияния на жизнеспособность хромосом в популяциях Drosophila melanogaster в разных регионах Северной Евразии. К настоящему моменту для популяций D. melanogaster Средней Азии (Ташкент, Бишкек) 2001 г., нами получены данные, позволяющие говорить об изменении частоты и активности генов мутаторов этого класса в сторону увеличения. В связи с этим обсуждается влияние МR-факторов на частоты летальных мутаций в популяциях.

В период с 1988 по 1993 г. были изучены частоты проявления самцовой рекомбинации (МR-активность) и жизнеспособность хромосом 2 в популяциях D. melanogaster Средней Азии (Душанбе), Украины (Умань), России (Юг Западной Сибири – Поспелиха, Змеиногорск, Горно-Алтайск).

Данные по частоте и активности МR-хромосом в популяциях, сгруппированные по регионам, таковы:

Душанбе, 1988, 1990. Изучена на МR-активность 201 хромосома, из них МR-активность проявили 54 хромосомы (26,9 %), «сильных»

МR-хромосом (частота рекомбинации более 0,5 %) – 1 (0,5 %).

Умань, 1991. Изучено 83 хромосомы, из них МR-хромосом – 15 (18,1%), «сильных» МR-хромосом – 1 (1,2 %).

Горно-Алтайск, Поспелиха, Змеиногорск, 1992. Изучено на МRактивность 85 хромосом, выявлено МR-хромосом – 25 (29,4 %), «сильных»

МR-хромосом – 1 (1,2 %).

Бишкек, Ташкент, 2001. Изучено на МR-активность 55 хромосом, выявлено МR-хромосом – 39 (70,9 %), «сильных» МR-хромосом – 25 (45,5 %).

Из приведенных данных видно, что в 2001 г. в среднеазиатских популяциях частота МR-хромосом составила 70,9 %, что более чем вдвое выше этой величины, наблюдавшейся в период с 1988 по 1992 г. в разных регионах Северной Евразии, включая среднеазиатский регион. При этом в среднеазиатских популяциях 2001 г. значительно выше частота «сильных» МRхромосом – 45,5 %, тогда как ранее эта величина не превышала 1,2 %.

Известно, что МR-факторы, выявляемые по способности хромосом рекомбинировать в геноме самцов D. melanogaster, являются мутаторами и индуцируют широкий спектр наследственных изменений от точковых мутаций до хромосомных перестроек. Логично предположить, что высокая частота МR-хромосом в популяциях и высокая частота «сильных»

МR-хромосом среди них могут повлиять на частоту летальных мутаций в популяции в сторону увеличения.

Частоты летальных мутаций в упомянутых популяциях таковы:

Душанбе, 1990. Изучено хромосом-2 на жизнеспособность 240, выявлена 41 хромосома, содержащая летальную мутацию (17,1 %).

Умань, 1991. Изучено хромосом-2 на жизнеспособность 136, выявлено 25 хромосом, содержащих летальную мутацию (18,4 %).

Бишкек, Ташкент, 2001 (данные по двум популяциям здесь усреднены). Изучено хромосом-2 на жизнеспособность 332, выявлено 58 хромосом, содержащих летальную мутацию (17,5 %).

Приведенные данные показывают, что частоты летальных мутаций в популяциях Душанбе, 1990 и Умань, 1991 – 17,1 и 18,4 % соответственно – не отличаются от таковых в популяциях Бишкека и Ташкента 2001 г. – 17,5 %.

Таким образом, нами показано, что двукратная разница в частоте МR-хромосом, сопровождающаяся также многократной разницей в частотах «сильных» МR-хромосом, никак не сказывается на частоте летальных мутаций в популяциях.

Работа выполнена при поддержке гранта РФФИ № 02-04-49251.

ГЕНЕТИЧЕСКИЙ АНАЛИЗ СОДЕРЖАНИЯ ГИДРОЛИЗУЕМЫХ

САХАРОВ У МУТАНТНЫХ ЛИНИЙ САХАРНОЙ КУКУРУЗЫ

–  –  –

Для селекционера необходимо знать систему генетического контроля количественных признаков, которые имеют сложную наследственную основу. На кафедре общей генетики, селекции и семеноводства были получены самоопыленные линии мутантной сахарной кукурузы. Целью настоящей работы является проведение генетического анализа и оценка самоопыленных линий мутантной сахарной кукурузы по содержанию гидролизуемых сахаров в системе диаллельных скрещиваний. Генетический анализ признака «содержание гиролизуемых сахаров» показал, что вклад эффектов окружающей среды в изучаемый признак, или средовая варианса Е, равен 0,378. Параметр D оценивает аддитивные эффекты и равен 22,366.

Доминантные эффекты уступают аддитивным, что показывают H1 = 15,833 и H2 = 14,748. Параметр F = -3,462 имеет отрицательное значение; это говорит о том, что в представленном наборе линий преобладают рецессивные гены или эффекты рецессивных генов. На основании отношения H1/D = 0,708 можно сделать вывод, что при наследовании длины початка у изучаемых линий преобладает неполное доминирование, а средняя степень доминирования д1/D = 0,841. Средняя степень доминирования в разных локусах неодинакова – это подтверждает отношение (H1-H2) =-0,351.

Оценки H1 и H2 почти равны, значит, доминантные и рецессивные аллели между родительскими сортами распределены почти равномерно. Отношение h2/H2 = 2,392 показывает, что по крайней мере три гена или блока генов при контроле длины початка в изучаемом наборе линий проявляют доминирование.

Научный руководитель – д-р биол. наук, проф. М.К. Керефова

ГЕНЕТИЧЕСКИЙ КОНТРОЛЬ ДИНАМИКИ ВЫСОТЫ РАСТЕНИЙ

КУКУРУЗЫ В СИСТЕМЕ ДИАЛЛЕЛЬНЫХ СКРЕЩИВАНИЙ

–  –  –

Знание системы контроля количественных признаков особо важно для характеристики новых самоопылённых линий кукурузы, включаемых в гибридизацию. Получены данные определяют генетические компоненты и гетерозисный эффект в процессе онтогенеза по высоте растений. Использованы шесть мутантных самоопылённых линий кукурузы в системе диаллельных скрещиваний по схеме p (p – 1)/2 и p (p – 1). Прирост растений кукурузы учитывали через каждые 2 дня, а затем суммировали за этап.

Периодизацию по этапам органогенеза метёлки проводили по Куперман (1955) и Керефовой (1961). Анализ гетерозиготного эффекта у гибридов на каждом из этапов (III-IX) органогенеза метёлки провели одновременно с определением типов генного действия по Hayman (1954) и Jones (1965). Об отсутствии неаллельного воздействия генов в контроле ростовых процессов главного побега свидетельствует коэффициент регрессии, который близок к 1. Характер генетических компонентов по высоте растений в онтогенезе шести самоопыленных линий и их гибридов, полученных в 2001 и 2002 гг., совпадает по общим схемам скрещиваний. В генетическом контроле признака “высота растений” у линий кукурузы при объeдинении их в гибриды установлено сверхдоминирование, которое отмечено на всех этапах органогенеза, направленноe на увеличение признака. При этом наблюдается симметрия в распределении доминантных и рецессивных аллелей. Оказалоcь, что высота растений в динамике контролируется сложной системой генных взаимодействий: аддитивным эффектом, доминированием и сверхдоминированием.

Научный руководитель – д-р биол. наук, проф. М.К. Керефова

ЭТАПЫ РАЗВИТИЯ ФЛОЭМНЫХ ВОЛОКОН СТЕБЛЯ ЛЬНА

–  –  –

Склеренхимные волокна отличают от других клеток две основные особенности: 1) длина этих клеток достигает нескольких сантиметров и более чем в 1 тыс. раз превышает ширину, 2) волокна имеют клеточную стенку толщиной до 10 мкм, тогда как толщина клеток других тканей составляет обычно 0,1–1 мкм. В силу этих особенностей клетки волокон являются очевидными объектами для изучения механизмов роста клетки и формирования клеточной стенки. Склеренхимные клетки стебля льна по происхождению являются первичными флоэмными волокнами. В своем развитии они проходят следующие стадии: дифференциацию, удлинение (координированный и интрузивный рост), утолщение клеточной стенки и ее созревание, отмирание цитоплазмы. В начале своего развития волокна развиваются по типу координированного роста без нарушения контактов с соседними клетками. На этой стадии роста клетки имеют вытянутую прямоугольную форму и закругленные концы. Длина клеток на этом этапе развития не превышает 100–200 мкм, диаметр – 4–7 мкм. На стадии интрузивного роста волокна внедряются концами между соседними клетками, плазмодесмы при этом разрушаются. По нашим данным, средняя длина зрелой клетки составляет 25 мм, однако в отдельных случаях длина может превышать среднее значение в 2-3 раза. Наряду с удлинением на стадии интрузивного роста волокна увеличиваются в диаметре с 7 до 15–20 мкм.

Созревание волокна включает в себя интенсивное утолщение клеточной стенки и изменение ее состава и структуры. В результате утолщения стенки люмен клетки сужается. Ультраструктурные исследования показали, что протопласт в волокне сохраняется вплоть до фазы желтой спелости, однако значительно раньше в цитоплазме волокон наблюдаются элементы деструкции: в клетке обнаруживаются цитосегресомы и большое количество липидных капель, наблюдается фрагментация цитоплазмы и появление мультивезикулярных тел в периплазме. Однако структура ядра заметно не меняется в ходе развития волокна. Характер отмирания цитоплазмы флоэмных волокон льна нельзя однозначно отнести ни к апоптозу, ни к некрозу.

–  –  –

В природных популяциях Drosophila melanogaster встречаются нестабильные мутации. Как правило, их нестабильность связана с активностью мобильных генетических элементов. Известно, что при транспозиции мобильных элементов на стадии вырезания неизбежно образуются двуцепочечные разрывы молекулы ДНК. Предполагается, что одним из факторов, контролирующих скорость инсерционного мутагенеза, является функциональное состояние клеточных ферментативных систем репарации. Целью работы было выявление характера мутирования нестабильных инсерционных аллелей в лабораторных линиях Drosophila melanogaster под влиянием генетического окружения, дефицитного по системе репарации. Исследовались 8 нестабильных аллелей генов Х-хромосомы (yellow, white и singed).

В специальных скрещиваниях Х-хромосомы самцов с нестабильным аллелем вводились в дефицитное по ферментам репарации окружение – в яйца самок, гомозиготных по мутации системы репарации. В качестве мутаций системы репарации использовались мутаген-чувствительные мутации mus302, mus308 и mus207. Еще одной особенностью взятых в эксперимент самок было наличие у них сцепленных Х-хромосом, что позволяло оценивать частоты локус-специфического мутирования уже в F1 по частоте появления исключительных потомков среди самцов. Получаемые частоты мутирования сравнивали с контролем. Выявлено, что мутации mus302 и mus308 приводят к снижению частот мутирования изученных нестабильных yellow-, white- и singed-аллелей, тогда как мутация mus207 усиливает мутабильность этих аллелей.

Работа выполнена при поддержке гранта РФФИ № 02-04-49251.

–  –  –

В селекции гибридов кукурузы определяющее значение имеет подбор пар. Установлено, что в генетических системах контроля количественных признаков принимают участие различные группы генов: модификаторы, гены с плейотропным действием и проявляющие эффект дозы, а также различную степень доминирования. Нами в 2002 г. получены данные по генетическому контролю количественных признаков у гибридов кукурузы при использовании мутантных самоопылённых линий селекции КБГУ, прошедших длительный отбор на комбинационную способность в системе диаллельных скрещиваний. Гибриды F1 были получены по полной диаллельной схеме скрещивания, а затем отбирали семьи F2 при самоопылении растений F1. Статистический анализ проводили по средним значениям семей F1 и F2. Анализ популяций родительских линий и их гибридов позволил определить гетерозис в F1 по таким количественным признакам, как высота растений, высота прикрепления верхнего початка, масса початка, масса зерна с початка. Гетерозис проявился по всем показателям, однако наивысший его показатель отмечали по массе зерна с початка и массе початка. Все гибриды F1 превзошли лучшую родительскую форму по этим показателям, и гетерозис был равен соответственно 92 и 61 %. В F 2 наблюдали инбредную депрессию, при этом линии в высокой СКС имели более низкую инбредную депрессию.

Научный руководитель – д-р биол. наук, проф. М.К. Керефова

МОЛЕКУЛЯРНАЯ БИОЛОГИЯ И БИОХИМИЯ

ПЕРЕКИСНОЕ ОКИСЛЕНИЕ ЛИПИДОВ

В ТКАНЯХ ЩИТОВИДНОЙ ЖЕЛЕЗЫ И НАДПОЧЕЧНИКОВ

У КРОЛИКОВ С ПОРАЖЕНИЕМ ПЕЧЕНИ И КОРРЕКЦИЯ

ВЫЯВЛЕННЫХ НАРУШЕНИЙ МЕМБРАНОСТАБИЛИЗАТОРАМИ

–  –  –

Длительно текущие хронические патологические состояния печени отражаются на эндокринной системе. Патогенетические механизмы пролиферации соединительной ткани в печени связывают со стимуляцией синтеза коллагена и гликозаминогликанов под влиянием продуктов перекисного окисления липидов (ПОЛ) [2, 4]. Исследованиями ряда авторов [5, 6, 8] показано умеренное увеличение уровня ТТГ, cнижение Т4 и T3, выраженность которых зависела от стадии цирроза. Развивающийся вторичный гипотиреоз существенно ухудшает течение патологического процесса. При поражениях печени изменяется содержание гормонов мозгового и коркового слоя надпочечников (НП) [9]. Механизм нарушения гормонального статуса при хронических диффузных поражениях печени не исследован.

Цель работы – исследовать процессы ПОЛ, активность ферментов антиоксидантной защиты (АОЗ) в гомогенате тканей щитовидной железы (ЩЖ) и НП при хроническом поражении печени и их коррекция мембраностабилизаторами.

На 18 кроликах-самцах с исходной массой тела 2,5–3,5 кг воспроизводили модель хронического поражения печени введением гелиотрина в дозе 30 мг/кг 1 раз в неделю в течение 8 недель. Затем животных разделяли на 4 группы и ежемесячно в течение 3 месяцев проводили лечение берберинбисульфатом, кобавитом и тефестролом в дозах 50, 30 и 1 мг/кг в течение 10 дней. Исследования проводили на 120-й день. В гомогенатах ЩЖ и НП определяли содержание малонового диальдегида (МДА) [1], активность ферментов супероксиддисмутазы (СОД) [7] и каталазы [3]. Цифровой материал обработан методом вариационной статистики.

Установлено, что у кроликов с хроническим гелиотринным гепатитом в гомогенате ЩЖ и НП возрастает уровень МДА в 2,62 и 2,94 раза на фоне существенного снижения активности СОД. Ели в гомогенате ЩЖ активность каталазы не изменялась, то в НП мы наблюдали ее увеличение в 1,41 раза. Выявленные изменения свидетельствуют о развивающихся деструктивных процессах в исследуемых тканях, что может способствовать снижению их функциональной активности. Это подтверждается исследованиями Г.С. Якобсона [9], где показано разрастание соединительнотканных прослоек, отходящих от утолщенной капсулы внутри НП при хронической интоксикации CCl4. По мере увеличения срока воздействия авторы наблюдали прогрессирование склеротических процессов и атрофию железистых тканей НП. Согласно данным [2, 4], одним из механизмов склерозирования является интенсификация ПОЛ, что приводит к стимуляции выхода из клеток склерозированных продуктов протеолиза. Видимо, эти процессы проходят не только в гепатоцитах, но и в других органах и системах, в частности железистых тканях, что и наблюдалось в проводимых нами экспериментах.

Экспериментальная фармакотерапия кобавитом снижала уровень липопероксидации в тканях ЩЖ и НП в 1,52 и 2,17 раза соответственно.

Однако несмотря на это изучаемый показатель все еще превышал параметры нормы, особенно в ЩЖ. Нами была выявлена лишь тенденция к повышению активности фермента АОЗ по отношению к параметрам группы животных, не подвергавшихся лечению. В отличие от него, фармакотерапия берберин-бисульфатом приводила к более выраженному снижению ПОЛ в гомогенате ЩЖ (в 2,53 раза), тогда как на уровень гиперлипопероксидации в гомогенате НП он не оказывал особого влияния (снижение лишь в 1,5 раза); причем если уровень МДА в гомогенате ЩЖ приблизился к значениям интактных кроликов, то в НП сохранялся достоверно выше в 1,96 раза. Активность ферментов АОЗ имела лишь тенденцию к увеличению. Фармакотерапия тефестролом снижала высокие значения МДА в обеих исследуемых тканях и приближала их к значению интактных кроликов. При этом было выявлено достоверное повышение активности СОД, особенно в гомогенате НП (в 1,58 раза).

Следовательно, использованные нами гепатопротекторы в определенной степени восстанавливали нарушенный баланс в системе ПОЛ/АОЗ, причем кобавит в основном влиял на ткань НП, берберин-бисульфат – на ЩЖ, а тефестрол – на обе ткани одинаково. Такие различия, на наш взгляд, связаны с особенностями механизма их действия. Так, кобавит является комплексным соединением кобальта, витамина U и глутаминовой кислоты, присутствие которых способствует активации ферментов второго этапа биотрансформации, что, возможно, определяет усиление печенью метаболизма гормонов, идущих с участием этих соединений. В отличие от него берберин-бисульфат оказывает большее влияние на желчеобразование и желчевыделение, стимулируя тем самым биосинтетические процессы в печени. Тефестрол является растительным гормоном и оказывает влияние на синтез эстрогенов. Несмотря на различия, эти препараты обладают выраженным антиоксидантным действием, что и наблюдалось в наших исследованиях.

––––––––––––––––––––––––

1. Андреева А.И., Кожемякин Л.А., Кишкун А.А. Модификация метода определения перекисей липидов в тесте с тиобарбитуровой кислотой // Лабораторное дело. 1989. №1. С. 41–49.

2. Венгеровский А.И., Батурина Н.О., Чучалин В.С., Саратиков А.С.

Роль перекисного окисления липидов в механизме пролиферации фиброзной ткани печени при экспериментальном хроническом гепатите // Патологическая физиология и экспериментальная терапия. 1996. № 2.

С. 37–39.

3. Коралюк М.А., Иванова Л.И., Майорова И.Г. Определение активности каталазы // Лабораторное дело. 1998. № 1. С. 16–19.

4. Логинов А.С., Матюшин Б.Н. Цитотоксическое действие активных форм кислорода и механизмы развития хронического процесса в печени при ее патологии // Патологическая физиология и экспериментальная терапия. 1996. № 4. С. 3–5.

5. Махмудов О.С., Кубанова Т.М. Изменение уровня гормонов щитовидной железы при хронических гепатитах у детей на фоне гормонотерапии // Вопросы охраны материнства и детства. 1991. № 8. С. 74.

6. Махмудов О.С., Курбанова Т.М., Мирахмедов М.М. Клиникофункциональное состояние щитовидной железы у детей с хроническими гепатитами и циррозом печени // Педиатрия. 1987. № 11. С. 108.

7. Мхитарян В.Г., Бадалян Г.Е. Влияние пероксидированных и непероксидированных ненасыщенных жирных кислот на активность супероксиддисмутазы // Журнал экспериментальной и клинической медицины.

1978. № 6. С. 7–12.

8. Рафикова С.У. Клинико-иммунологические особенности хронических заболеваний печени при различных функциональных состояниях щитовидной железы // Материалы пленума правления ВНОГ. М.; Смоленск,

1988. С. 312–314.

9. Якобсон Г.С. О роли кортикостероидных гормонов в патогенезе токсического гепатита и цирроза печени // Органосклерозы. Новосибирск,

1975. С. 942.

Научный руководитель – д-р мед. наук, проф. Х.Я. Каримов ВЛИЯНИЕ БАКТЕРИЙ PSEUDOMONAS SP. ШТАММ В-6798

НА РОСТ, РАЗВИТИЕ И УРОЖАЙНОСТЬ КАРТОФЕЛЯ

В ПОЛЕВЫХ УСЛОВИЯХ

–  –  –

Широкое и часто нерегулируемое применение пестицидов привело к загрязнению окружающей среды вследствие накопления этих веществ в почве и природных водах, что нанесло серьезный ущерб экологии и здоровью людей. В связи с этим в последние годы большое внимание уделяется развитию экологически чистых биологических методов борьбы с заболеваниями растений. Препараты на основе бактерий являются экологически чистыми и могут быть использованы в качестве агента биоконтроля и стимулятора роста растений. Цель данной работы – изучение влияния бактерий р. Pseudomonas шт. В-6798 в полевых условиях при обработке картофеля. Преимуществами данного штамма является его способность использовать формальдегид в составе минеральных сред в качестве единственного источника углерода и энергии, что позволит снизить затраты при производстве препарата. Предыдущие исследования показали, что данный штамм бактерий обладает фунгистатическим действием на ряд патогенных грибов и оказывает стимулирующее влияние на рост и развитие ряда сельскохозяйственных культур. В опыте использовался картофель двух сортов – Жуковский и Фреско. При посадке клубни картофеля в варианте «опыт» обрабатывались бактериями Pseudomonas sp. шт. В-6798 в концентрации 106 кл/мл в течение 30 мин, в варианте «чистый контроль»

(к1) – водой, в варианте «контроль» (к2) – препаратом «Планриз» (согласно инструкции) в качестве эталона для сравнения действия бактерий Pseudomonas sp. шт. В-6798. Повторная обработка проводилась одновременно с первым окучиванием. В это же время проводилась обработка макро- и микроудобрениями. В ходе эксперимента в течение месяца каждые четыре дня измерялась длина максимального побега в каждом кусте.

Уборка урожая проводилась с измерением массы клубней. При анализе данных было установлено: рост и количество побегов на варианте «опыт»

превышают контрольные; урожайность картофеля на сорте Фреско в варианте «опыт» по сравнению с к1 выше на 39,85 %, в к2 – на 32,72 %, на сорте Жуковском в опыте по сравнению с к1 прибавка урожая на 55,6 %, относительно к2 – 62 %. В настоящее время проводится анализ клубней в месте хранилища на зараженность фитопатогенами.

Научный руководитель – д-р биол. наук, проф. Е.В. Евдокимов

ПОЛУЧЕНИЕ ТРАНСГЕННЫХ ОСОБЕЙ D. MELANOGASTER,

ЭКСПРЕССИРУЮЩИХ ГЕН SYNTAXIN 13 В GAL4-UAS СИСТЕМЕ

–  –  –

Синтаксины – трансмембранные белки, играющие важную роль в везикулярном транспорте и процессе слияния мембран в клетке. Гены, кодирующие синтаксины, высоко консервативны и найдены у всех эукариот.

Для белков этого семейства характерно наличие трех доменов: консервативного С-концевого домена, закрепляющего белок в мембране, вариабельного N-концевого домена, который узнается регуляторными белками, и домена, отвечающего за образование комплекса, необходимого для слияния мембран. У D. melanogaster изучены только SYX1А и SYX5, остальные 9 представителей этого семейства предсказаны с помощью компьютерного анализа, а их предположительные функции основаны на гомологии с аналогичными синтаксинами млекопитающих. Помимо этого известно, что SYX1А дрозофилы необходим для процесса целлюляризации – особого типа цитокинеза в раннем эмбриогенезе дрозофилы, SYX5 также принимает участие в цитокинезе (в мейозе самцов).

Компьютерно предсказанный ген syntaxin 13 D. melanogaster находится в районе 69F6 третьей хромосомы. Для изучения тканеспецифичности экспрессии гена syntaxin 13 была использована Р-элементная инсерция, содержащая репортерный ген -галактозидазы P{ry+t7.2=PZ}, которая локализована в первом некодирующем экзоне гена syx13. Нами показано, что в эмбриогенезе экспрессия репортерного гена активируется, начиная с 9–10 стадии развития эмбриона, во всех сегментах с дорзальной стороны, при этом наиболее активное окрашивание наблюдается в антериор- и постериор-концах. На личиночной стадии окраска на -галактозидазу наблюдается во внешних пролиферативных центрах оптических долей нервных ганглиев, в ножных имагинальных дисках – в виде центрального пунктирного кольца, в крыловых имагинальных дисках – в виде кластера точек на границе крыло-нотум, в глазо-антеннальных – за морфогенетической бороздой. У имаго окраска наблюдается в некоторых районах семенников, по-видимому, соответствующих цистам.

Второй задачей данной работы было создание трансгенных особей, экспрессирующих ген syntaxin 13 в Gal4-UAS системе. Из литературных данных известно, что введение в клетку экзогенной ДНК, содержащей модифицированную копию синтаксина, приводило к нарушению функций нативного белка. Мы применили аналогичный подход и получили гибридную конструкцию, которая содержит модифицированную к ДНК гена syntaxin 13, кодирующую полипептид, усеченный с N-конца на 47 аминокислот. Мы предполагаем, что повреждение N-концевого домена приведет к нарушению узнавания синтаксина 13 другими белками, что приведет к нарушению его функций.

–  –  –

Фитин занимает центральное место в обмене фосфорных соединений у высших растений. Фитин наряду с остальными запасными веществами семян накапливается в процессе их созревания и используется только при прорастании. В алейроновых зернах хлопчатника фитин сосредоточен в глобоидах, тогда как запасные белки образуют кристаллоиды [1, 2, 3, 4, 5].

В связи с этим изучение динамики обмена фитина в клеточных структурах, где локализован субстрат, представляет большой научный интерес.

Хроматографические анализы показывают, что в алейроновых зернах семядолей и зародышевого корешка покоящихся семян хлопчатника фитин в основном представлен в свободной форме кальциевой, магниевой, калиевой солей миоинозитгексофосфорной кислоты. Содержание фосфора фитина в алейроновых зернах в обоих частях покоящихся семян приблизительно одинаковы (1,05–2,2 %). После прорастания семян хлопчатника в алейроновых зернах зародышевого корешка начинается интенсивная по сравнению с семядолями мобилизация фитина.

В процессе набухания семян хлопчатника в алейроновых зернах зародышевого корешка около 30 % фитина переходит в водорастворимую форму, а в семядолях – 10 %. У наклюнувшихся семян в зародышевых корешках на долю водорастворимого фитина приходится около 60–70 %, а в семядолях она равна 40–45 %. Интенсивный рост осевых органов сопровождается усиленной мобилизацией запасных веществ, а также оттоком последних из семядолей в органы. В алейроновой фракции трехдневных зародышевых корешков более 90 % фитина представлено в водорастворимой форме, а в семядолях он равен 65–70 %. Отмечено, что в алейроновых зернах зародышевого корешка на третьи сутки прорастания израсходовано 90–95 % фитина, а в семядолях он мобилизуется только в качестве 60–65 %. В алейроновой фракции семядолей у четырехдневных проростков содержание фитина снижалось почти на 90 % по сравнению с покоящимися семенами, в которых фитин на 80–85 % представлен в водорастворимой форме (в виде фитина белковых комплексов).

При хроматографическом исследовании фитина в алейроновых зернах различных частей прорастающих семян не обнаружено заметных количеств не полностью замещенных инозитфосфатов. В них найден только инозитгексофосфат. Неизвестно, происходит ли дефосфорилирование всей молекулы фитина in vivo одноактно, или этот процесс идет многоступенчато, но идет он очень быстро без накопления заметных количеств промежуточных продуктов. Многоступенчатость процесса дефосфорилирования является более вероятной, в опытах in vitro удалось показать многоступенчатость этого процесса. Среди продуктов реакции, кроме фитина, обнаруживаются инозиттетра-, инозиттри- и инозитдифосфаты, а также ортофосфат.

На основании полученных результатов можно предположить, что в процессе прорастания семян хлопчатника мобилизация запасного фосфорного соединения фитина в первую очередь начинается в осевых органах, тогда как семядоли хлопчатника как вместилище всех запасных соединений плавно мобилизуют последние.

––––––––––––––––––––––––

1. Асомов Д.К. Обмен фитина и некоторых фосфорных соединений в процессе созревания семян хлопчатника: Автореф. канд. дис. Ташкент, 1972.

2. Валиханов М.Н. Изучение фосфорного обмена в процессе прорастания семян хлопчатника: Автореф. канд. дис. М.: МГУ, 1964.

3. Ибрагимов М.Х. Превращение фосфорных соединений в прорастающих и созревающих семенах хлопчатника // Науч. тр. Ташкентского ун-та. 210.75. 1962.

4. Соболев А.М. О состоянии фитина в алейроновых зернах зрелых и прорастающих семян // Физ. раст. 13.193. 1966.

5. Валиханов М.Н., Игамназаров Р.П., Асамов Д.К. Фитаза прорастающих семян хлопчатника и её свойства // Физ. раст. 31.2. 1984.

Научный руководитель – канд. биол. наук, доц. Д.К. Асамов

ИЗМЕНЕНИЯ ВЯЗКОСТИ МЕМБРАН ЭРИТРОЦИТОВ

В УСЛОВИЯХ РАЗВИТИЯ КАНЦЕРОГЕНЕЗА

–  –  –

Клеточная мембрана – мишень для действия любых факторов в норме и при патологии, она отвечает приспособительной реакцией на изменение внешней среды. В опухолевых клетках происходит нарушение физикохимических свойств мембраны. Продукты секреции опухолевых клеток действуют угнетающе на многие здоровые органы и ткани и приводят к развитию паранеопластического синдрома. Зачастую летальный исход в послеоперационный период связан с интоксикацией организма продуктами жизнедеятельности опухолевых клеток. В связи с этим становится актуальной проблема исследования структурно-функциональных изменений в различных органах и тканях у онкологических больных. Ключевая роль в регуляции всех процессов в клетке принадлежит ферментам и рецепторам мембраны, интегральным показателем которой является ее текучесть. Поэтому целью нашей работы явилось изучение именно текучести мембран эритроцитов.

Исследования проводились на эритроцитах 16 онкологических больных, контрольную группу составляли 14 условно здоровых человек. Оценку относительной микровязкости мембран клеток крови осуществляли методом латеральной диффузии гидрофобного зонда пирена (С16Н10). Интенсивность флюоресценции пирена определяли на спектрофлуориметре AMINCO BOWMAN Siries2. В соответствии с полученными данными относительная микровязкость мембран эритроцитов в зоне липидного бислоя в контрольной группе составила 1,54 ± 0,26, а в зоне белок-липидного контакта – 2,42 ± 0,40; в то время как у больных раком в зоне липидного бислоя и в зоне белок-липидного контакта коэффициент экзимеризации был равен 1,03 ± 0,14 и 1,42 ± 0,20 соответственно. Таким образом, текучесть мембраны эритроцитов у онкологических больных по сравнению с эритроцитами здоровых людей снижена как в зоне липидного бислоя (на 33,3 %), так и в зоне белок-липидного контакта (на 41,3 %). Такое изменение текучести мембраны эритроцитов должно вызывать нарушение функций эритроцитов, что обусловливается ухудшением их способности к деформации. Подобные структурно-функциональные изменения красных клеток крови у онкологических больных неизбежно будут приводить к гипоксии различных органов и тканей.

Научные руководители – канд. биол. наук Т.Н. Замай, канд. физ.-мат. наук Е.В. Немцева

РАЗРАБОТКА МЕТОДА ОПРЕДЕЛЕНИЯ КОНЦЕНТРАЦИИ РНК

В БИОЛОГИЧЕСКИХ ЖИДКОСТЯХ И ИЗМЕРЕНИЕ

КОНЦЕНТРАЦИЙ РНК В КРОВИ ОНКОЛОГИЧЕСКИХ БОЛЬНЫХ

–  –  –

Достоверно показано, что внеклеточные нуклеиновые кислоты присутствуют как в супернатантах клеточных культур, так и во внеклеточной среде организма. Предприняты первые попытки использовать внеклеточные рибонуклеиновые кислоты для ОТ-ПЦР анализа мРНК маркерных онкогенов, при этом концентрации внеклеточных рибонуклеиновых кислот в супернатантах клеточных культур, в крови и других биологических жидкостях до сих пор не определены.

Целью представленной работы является разработка скринингового метода определения концентрации рибонуклеиновых кислот (в том числе в присутствии дезоксирибонуклеиновых кислот), пригодного для измерения концентрации РНК в биологических жидкостях.

Для выделения РНК из биологических жидкостей был адаптирован метод сорбции РНК на мелкодисперсном стекле. Данный метод обеспечивает количественное выделение высокомолекулярной РНК и 80 5 % РНК размером около 100 н.

Для определения концентрации РНК было использовано свойство красителя SYBR Green II формировать флуоресцирующие комплексы с РНК.

Рабочий диапазон определяемых при помощи этого красителя концентраций РНК составил 5–1000 нг/мл. Разработан метод определения концентрации РНК в присутствии ДНК. Концентрация РНК определяется этим методом по разнице концентраций нуклеиновых кислот определенных по флуоресценции их комплексов с красителем SYBR Green II и концентрации ДНК определенной при помощи флуоресцирующего интеркалирующего красителя Hoechst 33258. Достоверность анализа составляет 95 % в диапазоне концентраций от 10 до 1000 нг/мл, точность, характеризуемая коэффициентом вариации, составляет 8–10 %.

С помощью разработанных методов выделения и определения концентрации внеклеточной свободно циркулирующей РНК была определена ее концентрация в плазме крови здоровых доноров и больных раком молочной железы на различных стадиях заболевания.

–  –  –

В последние десятилетия серьезное внимание специалистов-медиков и широкой общественности привлечено к проблеме бесплодия, а также в настоящее время отмечается прогрессирующий рост мужского фактора в бесплодном браке. На мужскую фертильность влияют факторы химические, физические и бытовые. Для мужчин, которые в силу своей профессиональной деятельности подвергаются влиянию неблагоприятных факторов, для призывников и военнослужащих в горячих точках, для мужчин, которым предстоит вазоэктомия либо оперативное лечение по поводу заболевания с последующей лучевой и химиотерапией создание банка донорской спермы и аутобанка является актуальной задачей на сегодняшний день.

Во многих странах мира созданы банки спермы, и использование криоконсервированных сперматозоидов в настоящее время является повседневной практикой. Известно, что после криоконсервации наблюдается значительная изменчивость выживаемости сперматозоидов. На выживаемость сперматозоидов после криоконсервации (т. е. длительного хранения) влияет много факторов, а именно индивидуальное качество спермы, метод замораживания и размораживания, вид используемого криопротектора.

Цель настоящей работы состояла в изучении влияния различных криопротекторов на криорезистентность сперматозоидов человека. Анализ спермограммы, включающий в себя оценку концентрации, подвижности и морфологии сперматозоидов, является обязательным в диагностике нарушений репродуктивной функции мужчины. Для исследования использовались эякуляты мужчин, обратившихся в Центр репродуктивной медицины.

Было криоконсервировано 50 образцов эякулята двумя видами криопротекторов. Процент прогрессивноподвижных сперматозоидов после криоконсервации 10 %-м глицеролом составил в среднем 8,8 ± 0,43, а после 20 %-го ДМСО составил 4,2 ± 0,35 (Р=0,0001). Так, процент образцов эякулята с нормозооспермией составил 6 %, астенозооспермией – 44, олигоастенозооспермией – 30, олигозооспермией – 8, азооспермией – 4, астенотератозооспермией – 3, тератозооспермией – 3, олигоастенотератозооспермией – 2 %. Таким образом, при использовании 10 % – глицерола в качестве криопротектора подвижность сперматозоидов сохраняется в большей степени, чем при использовании 20 % – ДМСО.

Научные руководители – канд. биол. наук А.В. Светлаков, канд. биол.

наук Н.М. Титова, ст. науч. сотр. В.Г. Артюхова

НЕКОТОРЫЕ АСПЕКТЫ МОЛЕКУЛЯРНОЙ ДИВЕРГЕНЦИИ

КРИПТИЧЕСКИХ ВИДОВ A- и B-ФОРМ ANOPHELES MESSEAE

(DIPTERA; CULICIDAE)

О.В. Ваулин Томский государственный университет

Ранее было выявлено, что A- и B-формы малярийного комара Anopheles messeae, обладающие перекрывающимися спектрами инверсионных полиморфизмов, строго различаются с помощью таксонопринта, являясь по сути криптическими видами [1]. При использовании EcoRI B-форма дает полосу, соответствующую повторам длиной около 170 п.н., A-форма дает две полосы: около 65 и 110 п.н. Проведено секвенирование повторов, диагностирующих эту пару видов. Исследовано несколько клонов каждого типа. Полиморфизм последовательностей внутри каждой группы клонов выражался в мононуклеотидных заменах и вставках (делециях) нуклеотидов. Повтор B имеет длину 168–169 п.н., длинный повтор A – 117 п.н., короткий – 65 п.н. Все последовательности в парных сравнениях (три комбинации) обнаруживают участки с высокой степенью гомологии. Повторённая последовательность B-формы имеет значительные участки самогомологии. Результаты сравнения свидетельствуют о том, что диагностирующие последовательности видов An.

messeae имеют общее происхождение:

высокомолекулярная фракция могла подразделиться на две низкомолекулярные вследствие возникновения и фиксации в семействе повторов дополнительного EcoRI-сайта, или наоборот.

Проведен анализ последовательностей ITS2 у ряда видов. Анализ выявил очень малое число нуклеотидных замен, однако каждый вид имел уникальную последовательность ITS2. Методом UPGMA [3] построена схема филогенеза группы An. beklemishevi, цитогенетически далекой от An.

messeae, но обитающей симпатрично с этими двумя видами, оказался наиболее близок им по ITS2. Различие схем дивергенции, установленной по результатам цитогенетического [2] и молекулярно-генетического анализа, проблематично.

–––––––––––––––––––––––– Новиков Ю.М., Шевченко А.И. Инверсионный полиморфизм и 1.

дивергенция двух криптических форм таксона Anopheles messeae (Diptera, Culicidae) на уровне повторяющихся элементов геномной ДНК // Генетика.

2001. Т. 37. № 7. С. 915–925.

Стегний В.Н. Популяционная генетика и эволюция малярийных 2.

комаров. Томск: Изд-во ТГУ, 1991. 136 с.

Вейр Б. Анализ генетических данных. Дискретные генетические 3.

признаки. М.: Мир, 1995. 400 с.

–  –  –

С целью создания полиэпитопных вакцин против ВИЧ-1 был проведен поиск имитаторов антигенных детерминант с помощью эпитопных фаговых библиотек. Из рандомизованной пептидной библиотеки были отобраны бактериофаги, экспонирующие на своей поверхности пептиды, специфично связывающиеся с МКА 2F5 и 2G12. Указанные выше МКА обладают высокой вируснейтрализующей активностью. Известно, что образование вируснейтрализующих антител индуцируют многие конформационные эпитопы поверхностных гликопротеинов gp120 и gp41 ВИЧ-1. В связи с этим картирование конформационных эпитопов и идентификация пептидов – имитаторов конформационных эпитопов является перспективным для конструирования полиэпитопных вакцин против ВИЧ-1.

Известно, что короткие пептиды слабоиммуногенны и для повышения иммуногенности их необходимо присоединить к высокомолекулярному носителю.

Коровый белок вируса гепатита В (НВсАg) является одним из наиболее перспективных ВПЧ-векторов для экспонирования чужеродных детерминант. Привлекательность НВс-белка как носителя чужеродных эпитопов заключается в его способности к высокому уровню продукции и правильной самосборке в коровые частицы природной формы в различных системах экспрессии, а также в его высокой иммуногенности.

Ранее нами была создана плазмида рКНВс, кодирующая последовательность корового белка вируса гепатита В (НВсАg). Было показано, что в клетках E. coli, трансформированных рКНВс, синтезируется НВс-белок.

Он собирается в вирусоподобные частицы, которые по антигенности, размерам и морфологии подобны нативному кору. Встройки олигонуклеотидов, кодирующих мимитопы ВИЧ, были осуществлены в область, соответствующую 81 а. о. В данной работе описываются свойства полученных рекомбинантных белков.

Научный руководитель – канд. биол. наук Л.И. Карпенко

ИЗУЧЕНИЕ ЭКСПРЕССИИ ГЕНА ENV ВИРУСА

ИММУНОДЕФИЦИТА ЧЕЛОВЕКА В РАСТЕНИЯХ ТАБАКА

Е.Г. Волкова Новосибирский государственный университет

Создание эффективных систем иммунизации является интенсивно развивающейся областью генетической инженерии. Одним из наиболее безопасных вариантов вакцинирования являются субъединичные вакцины.

Однако для приобретения биологической активности полипептидам нередко требуется посттрансляционная модификация, которая может осуществляться только в эукариотических клетках. Минимизировать затраты на получение большого количества антигена удаётся при использовании растительных систем экспрессии. Кроме того, наработка антигена в съедобных частях растения сделает возможным использование их в качестве сьедобных вакцин, что позволит индуцировать в первую очередь иммунитет слизистой – первого барьера на пути вируса в организм. В настоящее время эпидемия ВИЧ стала одной из самых масштабных за всю историю угроз человечеству, вызываемых инфекционным агентом. Поэтому разработка вакцины против ВИЧ является необходимой мерой для предотвращения дальнейшего развития эпидемии.

Целью данной работы является получение и характеристика растений табака (в качестве наиболее изученной модели), продуцирующих белок gp120 – структурный компонент оболочки ВИЧ-1. Для этого на основе бинарного вектора создали две гибридные конструкции, содержащие ген env (кодирующий белок gp120) под контролем промоторов pE8 и p35S.

Промотор pЕ8 получен из генома томатов и работает в период созревания плодов; сильный конститутивный промотор p35S выделен из генома вируса мозаики цветной капусты. Нуклеотидная последовательность клонированного гена env была подтверждена секвенированием. Далее полученными гибридными конструкциями провели трансформацию Agrobacterium tumifaciens, с помощью которой бинарный вектор способен интегрировать часть своей ДНК в геном растения. Трансформацию растений табака проводили с помощью агробактериального переноса фрагмента ДНК полученных конструкций. Трансформанты растений табака были отобраны на селективной среде. Получено 75 растений, в настоящее время ведется анализ полученных трансформантов.

–  –  –

Эритроциты являются преобладающим типом клеток крови. Способность эритроцитов к упругой деформации позволяет им доставлять необходимые для жизнедеятельности организма вещества по сосудистой системе, включающей капилляры диаметром до 2 мкм. Деформируемость эритроцитов при прохождении по кровяному руслу обусловлена упругими свойствами их мембраны и наличием особой белковой структуры, выстилающей внутреннюю сторону мембраны и называемой цитоскелетом. Но при воздействии различных физико-химических факторов и при ряде заболеваний деформационная лабильность эритроцитов претерпевает существенные изменения.

Важным моментом при проведении исследований деформируемости эритроцитов является объективная оценка этого показателя. Для исследования деформируемости эритроцитов используются такие экспериментальные методы, как центрифугирование, фильтрация, реоскопия. Однако они либо недостаточно информативны, либо трудоемки по выполнению.

Метод, который позволяет провести оперативную и информативную оценку деформируемости эритроцитов, основан на компьютерной эктацитометрии и реализован в приборе, получившем название эктацитометр.

Целью нашего исследования явилось изучение влияния стресс-нагрузок на деформируемость эритроцитов крыс в опытах in vivo и воздействия на тот же показатель окислительного стресса in vitro с использованием Fe2+аскорбатной смеси в качестве активатора процессов пероксидации липидов.

Для исследования были определены следующие задачи:

1. Изучить влияние стресс-нагрузок на деформируемость эритроцитов крыс в опытах in vivo с использованием усовершенствованного эктацитометра.

2. Провести эктацитометрические исследования деформируемости эритроцитов, инкубированных в Fe2+-аскорбатной смеси.

Исследования проводились на белых крысах самцах линии Wistar в возрасте 6-8 месяцев весом 180-250 г.

Для исследования деформируемости эритроцитов использовали усовершенствованный эктацитометр, созданный на кафедре анатомии и физиологии человека и животных НГУ группой доцента А.В. Белкина.

Известно, что деформируемость эритроцитов изменяется под влиянием стресс-нагрузок на организм. В наших исследованиях в качестве факторов, влияющих на деформируемость эритроцитов, использовались такие стресс-нагрузки, как принудительное плавание и кратковременное перегревание, а в качестве гематологического критерия стрессорного состояния организма экспериментальных животных использовался анализ лейкоформулы. Как показали результаты исследования, после принудительного плавания крыс деформируемость эритроцитов достоверно увеличивалась на 27 %, а у крыс, подвергнутых кратковременному перегреванию, – на 45 % по сравнению с показателями контрольной группы. Подобный деформационный сдвиг некоторые авторы объясняют увеличением степени фосфорилирования белков мембранного скелета, но данные, полученные нами в опытах in vitro, не совсем согласуются с такими выводами.

Процесс пероксидации липидов, наблюдаемый в системе Fe2+-аскорбат, ведет к повышению проницаемости мембраны для многих ионов, в частности Са2+, в свою очередь, являющегося активатором некоторых протеинкиназ. Таким образом, теоретически деформационная лабильность неминуемо должна повышаться, но инкубация эритроцитов животного контрольной группы в системе Fe2+-аскорбат привела к достоверному снижению деформабильности эритроцитов на 32 %. Динамика деформационной лабильности эритроцитарной мембраны на разных стадиях стресса наводит на мысль о присутствии в крови стрессированных животных некого эффектора, воздействующего на белки мембранного скелета и мембрану в целом.

Дальнейшие исследования позволят нам выделить (пока теоретический) эффектор, определить его природу и детальнее изучить его влияние на систему реологических показателей крови.

Научный руководитель – канд. биол. наук, доц. О.В. Фролова

КЛОНИРОВАНИЕ ГЕНА SCHISTOSOMA MANSONI SM21.7 –

ПОТЕНЦИАЛЬНОГО КОМПОНЕНТА ВАКЦИНЫ ПРОТИВ

ШИСТОЗОМИАЗА

–  –  –

Шистозомиазис - болезнь, вызываемая внутривенным паразитом человека Schistosoma, – одно из самых распространенных паразитических заболеваний в странах с теплым климатом. По данным ВОЗ, на сегодня 200 млн человек заражены и 600 млн рискуют заразиться шистозомой.

Перспективным путем борьбы с заболеванием является создание вакцины на основе рекомбинантных антигенов шистозомы. В университете г. Бело Оризонте (Бразилия) группа профессора А. Гоеса выделила белковую фракцию (PIII) зрелого паразита Schistosoma mansoni, обладающую защитным эффектом при иммунизации. Задачей данной работы было клонирование генов, кодирующих белки этой фракции.

Выбор клонов производился путем скрининга кДНК–библиотеки зрелого паразита с помощью сыворотки кролика, иммунизированного PIII-фракцией. КДНК–библиотека была создана на основе мРНК зрелого паразита с использованием ZAP-cDNA Synthesis Kit (Stratagene). Вырезанной с помощью фага-помощника (М13) pBluescript фагмидой, несущей кДНК вставки и ген устойчивости к ампициллину, инфицировали линию E. coli XLOLR и высевали на агар с ампициллином и X-Gal. Колонии со вставками (белого цвета) выращивали в среде с IPTG, чтобы стимулировать синтез рекомбинантных белков. Бактериальные экстракты тестировали ELISA методом на связывание с анти-PIII-антителами.

Клон, синтезирующий белок, связывающий анти-PIII-антитела, был обнаружен после проверки 500 клонов. Электрофорез и Вестерн блот бактериальных белков выявили рекомбинантный белок с молекулярным весом 22кDa. IPTG стимулировал синтез рекомбинантного белка, количество последнего нарастало со временем. кДНК клона была амплифицирована с помощью универсального прямого (gttttgccagtcacggacgttgta) и обратного (caggaaacagctatgac) праймеров фага M13 и секвенирована с использованием «Thermo sequenase fluorescent labelled primer cycle sequencing kit».

BLAST–поиск гомологичных последовательностей в базе данных NCBI показал 100 %-ю идентичность с геном Schistosoma mansoni Sm21.7. Полученные результаты свидетельствуют, что клонированный ранее Sm21.7-ген кодирует белок, входящий в PIII-фракцию. Можно предполагать, что рекомбинантный белок обладает защитным действием и может быть использован для создания вакцины против инфекции Schistosoma mansoni.

Научный руководитель – канд. биол. наук Е.Н. Макарова

ВЛИЯНИЕ ПРЕПАРАТА «РИФТАЛ» НА НЕКОТОРЫЕ

ФИЗИОЛОГИЧЕСКИЕ ПРОЦЕССЫ, ПРОИСХОДЯЩИЕ

В ЛИСТЬЯХ РАСТЕНИЙ

–  –  –

В растениеводстве применяются стимуляторы роста растений с целью увеличения их продуктивности, биомассы, повышения устойчивости к вредителям, болезням и неблагоприятным факторам окружающей среды.

Стимуляторы роста также способны оказывать влияние на скорость роста и развития растений [1].

Синтетический препарат «Рифтал» является новым химическим соединением, действие которого направлено на ускорение роста растений и повышение их устойчивости в техногенно загрязненных условиях города.

Нами было изучено действие данного препарата на древеснокустарниковую растительность.

В начале вегетационного периода растения березы бородавчатой (Betula pendula Roth), чубушника широколистного (Philadelphus latifolius Schrad. ex. DC.), боярышника кроваво-красного (Crataegus sanguinea Pall.), ели сибирской (Picea obovata Ledeb.) были однократно обработаны водными растворами препарата «Рифтал» различной концентрации – 0,001 %, 0,005, 0,01 и 0,05 % (растения произрастают вдоль оживленной автомагистрали). Контрольные растения тех же видов, произраставшие в идентичных условиях, обработке препаратом «Рифтал» не подвергались.

Изучали изменение дыхания листьев и содержание пигментов в листьях. Для изучения дыхания использовался манометрический метод с использованием аппарата Варбурга [3]. В результате измерения дыхания опытных и контрольных растений было установлено, что при обработке растений препаратом «Рифтал» наиболее положительное влияние на березу бородавчатую оказывает раствор концентрации 0,01, 0,05 %, на ель сибирскую – раствор концентрации 0,001 %. При обработке препаратом «Рифтал» растений боярышника кроваво-красного и чубушника широколистного значительных увеличений в поглощении кислорода не наблюдается по сравнению с контрольными растениями.

Наибольшее количество хлорофилла А, хлорофилла В и каротиноидов наблюдалось в листьях березы бородавчатой, обработанной препаратом «Рифтал» концентрации 0,01 %; у ели больше хлорофилла А и каротиноидов при концентрации 0,005, 0,01 %, хлорофилла В – при концентрации 0,01 %; хлорофилла А, хлорофилла В, каротиноидов больше в листьях боярышника при обработке раствором «Рифтал» концентрации 0,001 %, а для чубушника – 0,01 %, но отмечается незначительное изменение содержания пигментов относительно контроля.

–––––––––––––––––––––––– Бабушкина Л.Г., Луганский Н.А. Комплексная оценка состояния 1.

лесных биогеоценозов в зоне промышленных загрязнений // Проблемы лесоведения и лесной экологии. Минск, 1990. С. 566–568.

Баславская С.С., Трубецкова О.М. Практикум по физиологии растений. М.: Изд-во МГУ, 1964. С. 105–125.

Настоящая работа выполнена в рамках исследований по гранту РФФИ № 02-03-97913.

–  –  –

Хронические патологические процессы в паренхиме печени при циррозах сопровождаются некрозом гепатоцитов с последующей активацией процессов фиброзирования. В связи с этим одним из перспективных направлений лечения фибропролиферативных заболеваний может быть разработка методов подавления активности фибробластов и одновременной стимуляции пролиферации гепатоцитов, восстанавливающей печеночную недостаточность. Одним из возможных подходов к решению этой проблемы может быть применение адреномиметиков. В настоящей работе мы исследовали влияние на регенерацию печени мышей с химически индуцированным циррозом одного из аналогов адреномиметиков – добутамина (добутирекса).

В предварительных экспериментах гепатоциты, полученные из интактной печени, культивировали в присутствии разных концентраций добутамина – от субклинических до клинических. Нами было показано, что добутамин по сравнению с эпидермальным фактором роста (EGF) более активно стимулирует пролиферативную активность гепатоцитов in vitro, причем оптимальной концентрацией является субклиническая (8 мкг/мл).

Также были проведены опыты по выяснению влияния добутамина на фибробласты. Оказалось, что в опытах in vitro добутамин подавляет пролиферацию фибробластов.

С целью выяснения действия препарата in vivo добутамин вводили не только интактным мышам, но и мышам, печень которых была стимулирована к регенерации различными воздействиями: частичной гепатэктомией (ЧГЭ) или CCl4. Полученные данные показывают, что добутамин стимулирует пролиферативную активность гепатоцитов после ЧГЭ и воздействия CCl4.

Таким образом, полученные данные свидетельствуют в пользу нашего предположения о том, что добутамин может повышать пролиферативную активность гепатоцитов печени мыши как in vitro, так и in vivo, и подавлять пролиферацию фибробластов in vitro.

Далее мы предположили, что добутамин может стимулировать регенерацию печени, а возможно и тормозить развитие фиброза при отравлении CCl4. Оказалось, что добутамин не только предотвращает развитие посттоксического цирроза, но и восстанавливает нормальное морфофункциональное состояние печени после токсического поражения.

Научный руководитель – д-р биол. наук Н.А. Сетков

ИСПОЛЬЗОВАНИЕ ПЫЛЬЦЫ КАК ПЕРЕНОСЧИКА

ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ

Х.А. Ибрагимов, Ф.У. Мустафина, Р.Х. Аллабердиев Национальный университет Узбекистана им. М. Улугбека На сегодняшний день научные работы продолжаются в направлении поиска и подбора новых, более эффективных способов получения трансгенных растений из хозяйственно-ценных культур, в том числе и хлопчатника [1, 2]. В работе изучалось использование пыльцы как переносчика генетической информации.

Проводились следующие виды работ:

1) подбор жидкой питательной среды для проращивания и стабилизации пыльцы хлопчатника, инкубация её с плазмидой, предназначенной для трансформации.

2) клонирование рекомбинантной плазмиды, которая в дальнейшем была использована в эксперименте [5].

3) анализ эксперимента по трансформации хлопчатника и интеграции плазмиды.

Эксперименты были проведены на тетраплоидных видах хлопчатника G. hirsutum (сорт 108-ф), G. barbadense (сорт 6037) Hybiscus grandiflorus [6].

Пыльцу выращивали на среде, содержащей 15 %-й раствор полиэтиленгликоля (ПЭГ) 6000, 20 %-й раствор сахарозы, 0,2 М СаCl2, 5 мМ КСl, 5 мМ Са(NO3)2, 1,5 мМ Н3ВО3, 0,02 %-й раствор цитохрома С, рН 5,6.

В экспериментах по трансформации хлопчатника методом прямого переноса была использованва гибридная плазмида pCaVItoxneo. Эта плазмида содержит гибридный ген двудоменного белка, N-концевая часть которого представляет собой активную часть y-эндотоксина В. thuringiensis var.

kurstahi HD-1, а С-концевая часть – ферментативно активную канамицинфосфаттрансферазу. Однако данный вектор недостаточно стабилен в геноме хлопчатника, поэтому решили дополнить состав плазмиды фрагментом растительной ДНК, благодаря которой гибридная плазмида могла бы автономно существовать в клетках растений. Такая плазмида была обнаружена, выделена из митохондрий хлопчатника и обозначена как pGhM2. Было сделано предположение, что при совмещении двух данных конструкций гибридная плазмида приобретает свойства автономности и интегративности от pGHm2, при этом гены от плазмиды pCaVItoxneo не утратят своей функциональности. Для получения гибридной плазмиды миникольцевая митохондриальная pGHm2 была обработана рестрикционным ферментом, а затем концы достраивали и лигировали с интегративной векторной плазмидой pCaVItoxneo, рестрикцированной по HindIII-сайту.

На рыльца пестиков растений-реципиентов наносили суспензию рыльцаплазмида. Для этого пыльцу помещали в искусственную питательную среду для проращивания пыльцы и туда же добавляли плазмиду до конечной концентрации 10 мкг на 1 мкл; вместе с пыльцой инкубировали до 30 мин при 28 0C, а затем переносили на рыльца пестиков растений-реципиентов. Концентрация для разных культур подбиралась индивидуально.

За время эксперимента было обработано 1172 цветка, из которых 400 – G. hirsutum и 772 – G. barbadense. В качестве контроля 50 цветков были обработаны суспензией пыльцы в растворе для проращивания без плазмиды. В конце периода созревания было получено 106 коробочек от G. hirsutum (168 Ф) и 318 коробочек от G. barbadense (С-6037). Был проведен первичный тест полученных семян на среде с канамицином. В опытных вариантах из 1908 (G. hirsutum) и 2226 (G. barbadense) семян получили 72 проростка (20 – от G. hirsutum и 52 – от G. barbadense). Дальнейший анализ был проведен только на этих проростках. Опытные семена были распределены между гель-электрофорезным анализом запасных белков полученных семян для высева с целью продолжения изучения наследования перенесенных генов в последующих поколениях [4].

––––––––––––––––––––––––

1. Ибрагимов А.П. Биосинтез белков и нуклеиновых кислот хлопчатника в онтогенезе // Фан. 1986. C. 116.

2. Конорев В.Г. Белки пшеницы. М.: Колос, 1980. С. 351.

3. Пирузян Э.С., Ангдриянов В.М. Плазмида агробактерий и генетическая инженерия растений. М.: Наука, 1985.

4. Anderson L., Anderson N.G. High resolution two-dimentional electroforesis of human plasma proteins // Proc. Natl. Acad. Sci. USA. 1977.

V 74. Р. 5422–5425.

5. Bajaj Y.P.S. Genetic engeneering and in vitro manipulation of plant

cells-technical advances // Biotechnology in adriculture and forestry. Berlin:

Springer-Verlag, 1989. V. 9. Р. 1–17.

6. Brewbaker J.L. Biology of the angiosperm pollen grains // Indian J. Genet. and Plant Breed. 1969. М. 19. Р. 121–133.

Научный руководитель – д-р биол. наук, акад. А.П. Ибрагимов

–  –  –

После аварии на ЧАЭС основным дозообразущим радионуклидом в настоящий момент является 137Cs. Население, проживающее на загрязненных территориях, получает дозовую нагрузку в основном за счет инкорпорации Cs, поступающего с пищей, что приводит к снижению индекса здоровья населения и росту заболеваний.

Как известно, грибы обладают высокими коэффициентами перехода радионуклидов из почвы. Цель данной работы – изучение динамики накопления у белых крыс 137Cs, содержащегося в сушеных грибах с удельной активностью 1300 кБк/кг.

Инкорпорацию 137Cs моделировали путем скармливания грибов самцам беспородных белых крыс в течение 24 суток, накопление радионуклидов при этом составило 10 кБк/кг. Анализ кривых накопления выявляет зависимость накопленной активности от продолжительности инкорпорации и описывается уравнением: у = 948,6Ln(x) – 313,36. У других животных инкорпорацию осуществляли на протяжении 7 суток (1500 Бк/кг) и 60 суток (1250 и 17000 Бк/кг) при скармливании разного количества грибов.

У животных с удельной активностью по 137Cs 1250, 1500, 17000 Бк/кг исследовали параметры митохондриального окисления кусочков миокарда, скелетной мускулатуры, печени и почек полярографическим методом.

При краткосрочном поступлении 137Cs и удельной активности животных 1250 Бк/кг (21 мкЗв) произошло увеличение скорости дыхания на эндогенных субстратах в миокарде на 65 %, в скелетных мышцах – на 40 %. В печени наблюдалось уменьшение этого показателя на 20 %. Более длительное поступление 137Cs до удельной активности 1500 Бк/кг (169 мкЗв) сопровождалось уменьшением эндогенного дыхания только в миокарде на 21 %, а при уровне 17 000 Бк/кг – на 19 %. В то же время в ткани печени и почках эти показатели остались без изменения.

Полученные данные подтверждают высокую чувствительность показателей митохондриального окисления к действию таких антропогенных факторов, как 137Cs.

Научные руководители – проф. А.М. Дворник, д-р мед. наук А.И. Грицук

КОНФОРМАЦИОННАЯ ЛАБИЛЬНОСТЬ БЕЛКОВОЙ ГЛОБУЛЫ

И ФЕРМЕНТАТИВНАЯ АКТИВНОСТЬ Na+,K+-АТФАЗЫ

В РАЗНЫХ ТИПАХ ТКАНЕЙ КРЫС

–  –  –

Na+,K+-АТФаза плазматических мембран клеток организма представляет собой молекулярный субстрат Na+-насоса и играет ключевую роль как в поддержании ионного гомеостаза в отдельных клетках, так и в регуляции водно-солевого обмена на уровне целого организма.

Открытая более 40 лет назад Na+,K+-АТФаза и в настоящее время привлекает внимание исследователей. Но если в первые годы открытия фермента основные усилия были направлены на изучение ее структуры и функций, то в последнее время внимание уделяется проблемам регуляции активности Na+,K+-АТФазы, так как этот фермент играет существенную роль в функционировании разных тканей. Выполняя одну и ту же роль создателя градиентов концентрации ионов натрия и калия, Na+,K+-АТФаза вовлечена в разных тканях в осуществление разных физиологических функций. По этой причине изучение механизмов регуляции активности Na+,K+-АТФазы представляет существенный интерес для понимания механизмов регуляции функций разных тканей.

Целью нашего исследования явилось изучение активности Na+, K+АТФазы и уабаин-чувствительной K+-фосфатазы в различных типах тканей крыс в присутствии разных концентраций иона-модификатора.

В исследовании были сформулированы следующие задачи:

1. Определить активность Na+,K+-АТФазы в конформации Е1 и Е2 в разных типах тканей крыс.

2. Изучить влияние концентрации Мg2+ на конформационную лабильность белковой глобулы Na+,K+-АТФазы в реакционном цикле.

Исследования проводились на белых крысах самцах линии Wistar в возрасте 6-8 месяцев весом 180-250 г. В экспериментах по определению активности фермента использовали гомогенат серого вещества головного мозга, гомогенат мозгового слоя почки и эритроциты.

Na+,K+-АТФаза в ходе реакционного цикла функционирует в двух конформационных состояниях Е1 и Е2. В процессе эксперимента обнаружены значительные различия активности энзима в разных тканях. Для конформации Е1 характерны следующие соотношения активности: в гомогенате мозгового слоя почки она составила 85 % от общей АТФазной активности, в гомогенате серого вещества головного мозга – 57 %, а в эритроцитах – 20 %. Динамика изменения активности фермента в конформации Е 2 носит аналогичный характер: в гомогенате мозгового слоя почки – 19 %, гомогенате серого вещества головного мозга – 12,5, в эритроцитах – 4,5 %.

Распределение активностей фермента прежде всего связано с разной плотностью Na+,K+-АТФазы в плазматических мембранах клеток от нескольких молекул на один квадратный микрометр эритроцитарной мембраны до нескольких тысяч молекул на той же площади в эпителии нефрона или возбудимых тканях.

Белковая глобула фермента в конформации Е1 представлена олигомерным ансамблем, а в конформации Е2 существует в форме разобщенных протомеров. Модификатором ферментативной системы, переводящим ее из одного конформационного состояния в другое, являются Mg2+, которые участвуют в образовании субстрата Mg-АТФ, гидролизуемого Na+,К + АТФазой, и одновременно ускоряют превращение фермента из конформационного состояния Е1 в Е2. Учитывая вышесказанное, в ходе эксперимента параллельно определяли активность Na+,К + -АТФазы в конформации Е1 и Е2 при разных концентрациях Mg2+ в среде инкубации в различных типах тканей крыс. При увеличении концентрации иона в среде инкубации от 0,5 – 3 мМ наблюдается выраженное повышение активности Na+,К + АТФазы в конформации Е1. При увеличении концентрации Mg2+ до 12 мМ наблюдалось существенное снижение активности Na+,К + -АТФазы. Данный эффект может быть связан с тем, что увеличение концентрации Mg2+ в среде инкубации выше 3 мМ стимулирует конформационный переход фермента из Е1- в Е2-форму, что сопровождается снижением Na+,К + АТФазной и повышением К+-фосфатазной активности фермента. Действительно, параллельное определение активности фермента в конформации Е 2 в интервале концентраций Mg2+ среде инкубации от 3 до 12 мМ показывает существенный прирост этой активности, что подтверждает представления о сдвиге конформации фермента в сторону Е2 под действием высоких концентраций Mg2+. Анализ полученных результатов позволил предположить, что максимальной конформационной лабильностью обладают белковые глобулы фермента, встроенные в эритроцитарную мембрану, что подтверждается нативной целостностью и физико-химическими характеристиками клеток крови в отличие от тканей, подвергнутых в ходе эксперимента гомогенизации.

Научный руководитель – канд. биол. наук, доц. О.В. Фролова

ФУНКЦИОНАЛЬНОЕ СОСТОЯНИЕ Na+,К+-АТФАЗЫ

В ЭРИТРОЦИТАХ ОНКОЛОГИЧЕСКИ БОЛЬНЫХ ЛЮДЕЙ

–  –  –

В настоящее время возрастает число онкологических больных, поэтому исследования патологий являются перспективным направлением современной медицины. Продукты секреции опухолевых клеток угнетающе действуют на все органы и ткани организма (паранеопластический синдром), и зачастую летальный исход онкологических больных в послеоперационный период вызван интоксикацией организма продуктами жизнедеятельности опухолевых клеток. В связи с этим актуальной является проблема исследования структурно-функциональных изменений в различных органах и тканях у онкологических больных. Наиболее доступным объектом для исследования клинических проявлений паранеопластического синдрома являются эритроциты, выполняющие в организме важнейшую функцию обеспечения организма кислородом. Целью нашей работы явилось изучение функционального состояния Na+,К+-АТФазы в эритроцитах здоровых людей и онкологических больных (рак тела матки).



Pages:   || 2 | 3 | 4 |
Похожие работы:

«Палий Иван Николаевич ФИЗИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ AGASTACHE FOENICULUM PURSH. И NEPETA CATARIA VAR. CITRIODORA BECK. В УСЛОВИЯХ ЮЖНОГО БЕРЕГА КРЫМА 03.01.05 – физиология и биохимия растений Диссертация на соискание научной степени кандидата биологических наук Научный руководитель: доктор биологических наук Ильницк...»

«Скамрова Галина Борисовна КОМБИНИРОВАННОЕ ДЕЙСТВИЕ СЛАБОГО МИКРОВОЛНОВОГО ИЗЛУЧЕНИЯ И ДНК-СВЯЗЫВАЮЩИХСЯ ПРЕПАРАТОВ НА КЛЕТКИ БУККАЛЬНОГО ЭПИТЕЛИЯ ЧЕЛОВЕКА Специальность 03.01.02 – Биофизика Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор физико-математическ...»

«ISSN 2224-5308 АЗАСТАН РЕСПУБЛИКАСЫ ЛТТЫ ЫЛЫМ АКАДЕМИЯСЫНЫ ХАБАРЛАРЫ ИЗВЕСТИЯ NEWS НАЦИОНАЛЬНОЙ АКАДЕМИИ НАУК OF THE NATIONAL ACADEMY OF SCIENCES РЕСПУБЛИКИ КАЗАХСТАН OF THE REPUBLIC OF KAZAKHSTAN БИОЛОГИЯ ЖНЕ МЕДИЦИНА СЕРИЯСЫ СЕРИЯ БИОЛОГИЧЕСКАЯ И МЕДИЦИНСКАЯ...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФГАОУ ВО Новосибирский национальный исследовательский государственный университет Факультет естественных наук УТВЕРЖДАЮ Декан ФЕН НГУ, профессор _ Резников В.А. «_29_»августа 2014 г. Эко...»

«ПРЕЗЕНТАЦИЯ НА ТЕМУ ЭКОЛОГИЧЕСКИЕ ГРУППЫ РАСТЕНИЙ ПО ОТНОШЕНИЮ К АБИОТИЧЕСКИМ ФАКТОРАМ. ПОДГОТОВИЛА СУХАНОВА МАРИЯ 11 А КЛАСС ЯНВАРЬ 2016Г. ФАКТОРЫ • 1) АБИОТИЧЕСКИЕ (СВЕТ, ВОДА, ТЕМПЕРАТУРНЫЙ РЕЖИМ) • 2) ЭДАФИЧЕСКИЕ(ФИЗИЧЕСКИЕ ИЛИ Х...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ КАРАЧАЕВО-ЧЕРКЕССКОЙ РЕСПУБЛИКИ XIII КАРАЧАЕВО ЧЕРКЕССКАЯ РЕСПУБЛИКАНСКАЯ ОТКРЫТАЯ НАУЧНОДАР» КРАЕВЕДЧЕСКАЯ КОНФЕРЕНЦИЯ НАУЧНОГО ОБЪЕДИНЕНИЯ УЧАЩИХСЯ (ДЕТСКАЯ АКАДЕМИЯ РАЗВИТИЯ) СЕКЦИЯ «ПРИРОДНОЕ НАСЛЕДИЕ » Выполнила: Брошко...»

«ПОЯСНИТЕЛЬНАЯ ЗАПИСКА Рабочая программа составлена на основе Примерной программы основного общего образования по биологии с учетом авторской программы А.Г.Драгомилова, Р.Д. Маш по курсу « Человек и его здоровье». Структура курса складываетс...»

«Управление образования администрации Старооскольского городского округа Муниципальное образовательное учреждение дополнительного образования детей «Центр эколого – биологического образования»УТВЕРЖДЕНА: РАССМОТРЕНА РАССМОТРЕНА муниципальным на заседании педагогического Приказом директора экспертным советом управлен...»

«Башмаков Виктор Юрьевич БИОХИМИЧЕСКАЯ И ЭКСПРЕССИОННАЯ РЕГУЛЯЦИЯ ПУТЕЙ РАЗОБЩЕНИЯ ДЫХАНИЯ И ОКИСЛИТЕЛЬНОГО ФОСФОРИЛИРОВАНИЯ ПРИ ЭКСПЕРИМЕНТАЛЬНОМ ДИАБЕТЕ И СВЕТЛОКЛЕТОЧНОМ РАКЕ ПОЧКИ Специальность 03.01.04 – биохимия Диссертац...»

«ПРАКТИКУМ ПО БИОЛОГИЧЕЕСКОЙ ЗАЩИТЕ РАСТЕНИЙ С ОСНОВАМИ ОБЩЕЙ ЭНТОМОЛОГИИ СОДЕРЖАНИЕ ВВЕДЕНИЕ Раздел I. ОСНОВЫ ОБЩЕЙ ЭНТОМОЛОГИИ (6) Тема 1. МОРФОЛОГИЯ, АНАТОМИЯ И БИОЛОГИЯ НАСЕКОМЫХ (6) 1.1. Морфология насекомых (6) 1.2. Анатомия насекомых (16...»

«МУНИИПАЛЬНОЕ АВТОНОМНОЕ ОБЩЕОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ЛИЦЕЙ №7 г.ТОМСКА Сценарий открытого урока английского языка в 8 классе по теме “GLOBAL ISSUES” Лазарева С.В., учитель английского языка МАОУ лицея №7 г.Томска Технологическ...»

«Негинская Мария Александровна МЕХАНИЗМЫ КАЛЬЦИЕВОЙ СИГНАЛИЗАЦИИ НЕЙРОНОВ И АСТРОЦИТОВ ПРИ ФОТОДИНАМИЧЕСКОМ ВОЗДЕЙСТВИИ РАДАХЛОРИНА Специальность: 03.01.02 – Биофизика Диссертация на соискание учёной степени...»








 
2017 www.pdf.knigi-x.ru - «Бесплатная электронная библиотека - разные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.